FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627611_at:

>probe:Drosophila_2:1627611_at:157:331; Interrogation_Position=125; Antisense; GCGGTGGCAACAAGGAACTCCAACT
>probe:Drosophila_2:1627611_at:381:195; Interrogation_Position=146; Antisense; AACTGGACATGGGTGGCTTCAAGAA
>probe:Drosophila_2:1627611_at:121:229; Interrogation_Position=193; Antisense; AATGGCAGTGATTCGCTGCCGCCTA
>probe:Drosophila_2:1627611_at:28:627; Interrogation_Position=209; Antisense; TGCCGCCTAGCATGGACTTTGATGA
>probe:Drosophila_2:1627611_at:704:579; Interrogation_Position=24; Antisense; GGCCAAGCAAGCGTACTTCGTTAAT
>probe:Drosophila_2:1627611_at:115:431; Interrogation_Position=253; Antisense; GAGTTTGGCCGATATCAGAAGCTAC
>probe:Drosophila_2:1627611_at:285:109; Interrogation_Position=269; Antisense; AGAAGCTACTGTTCATCTGCATGAT
>probe:Drosophila_2:1627611_at:683:57; Interrogation_Position=289; Antisense; ATGATCCCATTCTCGTTTTTCGTGG
>probe:Drosophila_2:1627611_at:669:693; Interrogation_Position=306; Antisense; TTTCGTGGCCTTTGTGTACTTCTCA
>probe:Drosophila_2:1627611_at:566:489; Interrogation_Position=321; Antisense; GTACTTCTCACAAATATTCCTCACC
>probe:Drosophila_2:1627611_at:686:243; Interrogation_Position=333; Antisense; AATATTCCTCACCTTGATACCCGAA
>probe:Drosophila_2:1627611_at:161:457; Interrogation_Position=348; Antisense; GATACCCGAACAGCATTGGTGTCAT
>probe:Drosophila_2:1627611_at:698:3; Interrogation_Position=362; Antisense; ATTGGTGTCATGTGCCCGAGTTGGA
>probe:Drosophila_2:1627611_at:720:207; Interrogation_Position=50; Antisense; AAGCATTTACCTACGAGGAGCCGCC

Paste this into a BLAST search page for me
GCGGTGGCAACAAGGAACTCCAACTAACTGGACATGGGTGGCTTCAAGAAAATGGCAGTGATTCGCTGCCGCCTATGCCGCCTAGCATGGACTTTGATGAGGCCAAGCAAGCGTACTTCGTTAATGAGTTTGGCCGATATCAGAAGCTACAGAAGCTACTGTTCATCTGCATGATATGATCCCATTCTCGTTTTTCGTGGTTTCGTGGCCTTTGTGTACTTCTCAGTACTTCTCACAAATATTCCTCACCAATATTCCTCACCTTGATACCCGAAGATACCCGAACAGCATTGGTGTCATATTGGTGTCATGTGCCCGAGTTGGAAAGCATTTACCTACGAGGAGCCGCC

Full Affymetrix probeset data:

Annotations for 1627611_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720