FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627613_at:

>probe:Drosophila_2:1627613_at:438:567; Interrogation_Position=111; Antisense; GGCAGAGCCTCATCGTCACCAGGGA
>probe:Drosophila_2:1627613_at:342:127; Interrogation_Position=128; Antisense; ACCAGGGACCCATTTTCGATACGAG
>probe:Drosophila_2:1627613_at:112:1; Interrogation_Position=135; Antisense; ACCCATTTTCGATACGAGGCCGTCG
>probe:Drosophila_2:1627613_at:349:581; Interrogation_Position=163; Antisense; TTCAATCCTAACCAACCAAGACCGG
>probe:Drosophila_2:1627613_at:121:645; Interrogation_Position=199; Antisense; TAAATTGACAGTGGGAAATTCACAC
>probe:Drosophila_2:1627613_at:487:653; Interrogation_Position=20; Antisense; TCAATTCCCGCCACCGAGCTAAGAT
>probe:Drosophila_2:1627613_at:556:559; Interrogation_Position=212; Antisense; GGAAATTCACACTGCTGATGTCGTT
>probe:Drosophila_2:1627613_at:383:651; Interrogation_Position=218; Antisense; TCACACTGCTGATGTCGTTAACACA
>probe:Drosophila_2:1627613_at:17:335; Interrogation_Position=225; Antisense; GCTGATGTCGTTAACACATTGATAA
>probe:Drosophila_2:1627613_at:238:301; Interrogation_Position=28; Antisense; CGCCACCGAGCTAAGATGCAACTTA
>probe:Drosophila_2:1627613_at:727:445; Interrogation_Position=42; Antisense; GATGCAACTTAATCTTGGAGCGATT
>probe:Drosophila_2:1627613_at:596:121; Interrogation_Position=60; Antisense; AGCGATTTTTCTGGCCCTGCTGGGT
>probe:Drosophila_2:1627613_at:519:309; Interrogation_Position=92; Antisense; CCACGGCTACATCAGTGCTGGCAGA
>probe:Drosophila_2:1627613_at:424:667; Interrogation_Position=99; Antisense; TACATCAGTGCTGGCAGAGCCTCAT

Paste this into a BLAST search page for me
GGCAGAGCCTCATCGTCACCAGGGAACCAGGGACCCATTTTCGATACGAGACCCATTTTCGATACGAGGCCGTCGTTCAATCCTAACCAACCAAGACCGGTAAATTGACAGTGGGAAATTCACACTCAATTCCCGCCACCGAGCTAAGATGGAAATTCACACTGCTGATGTCGTTTCACACTGCTGATGTCGTTAACACAGCTGATGTCGTTAACACATTGATAACGCCACCGAGCTAAGATGCAACTTAGATGCAACTTAATCTTGGAGCGATTAGCGATTTTTCTGGCCCTGCTGGGTCCACGGCTACATCAGTGCTGGCAGATACATCAGTGCTGGCAGAGCCTCAT

Full Affymetrix probeset data:

Annotations for 1627613_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720