Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627614_at:

>probe:Drosophila_2:1627614_at:252:53; Interrogation_Position=3932; Antisense; ATGCAAACGGTCTCGAAAGCGCTTT
>probe:Drosophila_2:1627614_at:533:391; Interrogation_Position=3946; Antisense; GAAAGCGCTTTTGCAGCCGACTGCA
>probe:Drosophila_2:1627614_at:346:353; Interrogation_Position=3958; Antisense; GCAGCCGACTGCAAATGAATTTCAT
>probe:Drosophila_2:1627614_at:31:679; Interrogation_Position=3988; Antisense; TAGTTGTACGATTGAGCTATCTCAC
>probe:Drosophila_2:1627614_at:59:157; Interrogation_Position=4017; Antisense; ACACCCCACTCACAATGAACATTTA
>probe:Drosophila_2:1627614_at:441:491; Interrogation_Position=4064; Antisense; GTAACTTACCTGGAATGAGCATTTA
>probe:Drosophila_2:1627614_at:269:261; Interrogation_Position=4124; Antisense; CACCTCCACATCCATTTGTATTTGT
>probe:Drosophila_2:1627614_at:593:721; Interrogation_Position=4185; Antisense; TTGCCATTTACAAAGCTTCAGTTAA
>probe:Drosophila_2:1627614_at:159:605; Interrogation_Position=4221; Antisense; TGATTGCCATCTTTTTACACCTAGC
>probe:Drosophila_2:1627614_at:595:339; Interrogation_Position=4244; Antisense; GCATTTAGTCGTCTAGTTACCCTAG
>probe:Drosophila_2:1627614_at:491:699; Interrogation_Position=4281; Antisense; TTTATGAACTGCAAACGCGAACCTC
>probe:Drosophila_2:1627614_at:366:199; Interrogation_Position=4294; Antisense; AACGCGAACCTCATCGAACCCTTTG
>probe:Drosophila_2:1627614_at:286:381; Interrogation_Position=4309; Antisense; GAACCCTTTGCCTTACTTATCATTT
>probe:Drosophila_2:1627614_at:349:465; Interrogation_Position=4365; Antisense; GTTGATTTAGTTACTCCTCGGAGCA

Paste this into a BLAST search page for me
ATGCAAACGGTCTCGAAAGCGCTTTGAAAGCGCTTTTGCAGCCGACTGCAGCAGCCGACTGCAAATGAATTTCATTAGTTGTACGATTGAGCTATCTCACACACCCCACTCACAATGAACATTTAGTAACTTACCTGGAATGAGCATTTACACCTCCACATCCATTTGTATTTGTTTGCCATTTACAAAGCTTCAGTTAATGATTGCCATCTTTTTACACCTAGCGCATTTAGTCGTCTAGTTACCCTAGTTTATGAACTGCAAACGCGAACCTCAACGCGAACCTCATCGAACCCTTTGGAACCCTTTGCCTTACTTATCATTTGTTGATTTAGTTACTCCTCGGAGCA

Full Affymetrix probeset data:

Annotations for 1627614_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime