FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627616_at:

>probe:Drosophila_2:1627616_at:424:671; Interrogation_Position=1095; Antisense; TACCGATTGGTTTCGTACGTAGCAA
>probe:Drosophila_2:1627616_at:591:711; Interrogation_Position=1106; Antisense; TTCGTACGTAGCAAACTGACCATTT
>probe:Drosophila_2:1627616_at:278:283; Interrogation_Position=1121; Antisense; CTGACCATTTTGTAAGGCATTTGCT
>probe:Drosophila_2:1627616_at:137:599; Interrogation_Position=694; Antisense; TGTCCGGCAATCCACTGATGAACTA
>probe:Drosophila_2:1627616_at:96:139; Interrogation_Position=707; Antisense; ACTGATGAACTATGAGCCCGGCACC
>probe:Drosophila_2:1627616_at:466:287; Interrogation_Position=757; Antisense; CTGGACTGGGCGGTGATCTAAAGAT
>probe:Drosophila_2:1627616_at:605:663; Interrogation_Position=781; Antisense; TAAAGCGCCGCTGGGACGATGATGT
>probe:Drosophila_2:1627616_at:514:537; Interrogation_Position=806; Antisense; GGTCTTTAAGAATTGCGCCAGATCT
>probe:Drosophila_2:1627616_at:333:97; Interrogation_Position=825; Antisense; AGATCTGCGCCCGATAAGAAGACGC
>probe:Drosophila_2:1627616_at:446:409; Interrogation_Position=845; Antisense; GACGCACTTCGTCAATGACGCCCTG
>probe:Drosophila_2:1627616_at:696:623; Interrogation_Position=868; Antisense; TGCGCTCCGATTTCCACAAGAAGTT
>probe:Drosophila_2:1627616_at:621:13; Interrogation_Position=906; Antisense; ATTAAGTAGGCAGCATCTGGGACTC
>probe:Drosophila_2:1627616_at:184:641; Interrogation_Position=921; Antisense; TCTGGGACTCGCTCTCAAGTTTCAG
>probe:Drosophila_2:1627616_at:66:185; Interrogation_Position=977; Antisense; AACAATTGTCAACCCTCTTTGTCCT

Paste this into a BLAST search page for me
TACCGATTGGTTTCGTACGTAGCAATTCGTACGTAGCAAACTGACCATTTCTGACCATTTTGTAAGGCATTTGCTTGTCCGGCAATCCACTGATGAACTAACTGATGAACTATGAGCCCGGCACCCTGGACTGGGCGGTGATCTAAAGATTAAAGCGCCGCTGGGACGATGATGTGGTCTTTAAGAATTGCGCCAGATCTAGATCTGCGCCCGATAAGAAGACGCGACGCACTTCGTCAATGACGCCCTGTGCGCTCCGATTTCCACAAGAAGTTATTAAGTAGGCAGCATCTGGGACTCTCTGGGACTCGCTCTCAAGTTTCAGAACAATTGTCAACCCTCTTTGTCCT

Full Affymetrix probeset data:

Annotations for 1627616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720