FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627617_at:

>probe:Drosophila_2:1627617_at:199:715; Interrogation_Position=2547; Antisense; TTCTGGCCGGCGGAGATCAGTTCTC
>probe:Drosophila_2:1627617_at:178:453; Interrogation_Position=2561; Antisense; GATCAGTTCTCCAATTCGACGATGA
>probe:Drosophila_2:1627617_at:72:395; Interrogation_Position=2584; Antisense; GAAATCGGAGGACGCCATCAACGGC
>probe:Drosophila_2:1627617_at:572:251; Interrogation_Position=2602; Antisense; CAACGGCAGTTGAAGGACACCTAGT
>probe:Drosophila_2:1627617_at:370:379; Interrogation_Position=2617; Antisense; GACACCTAGTATTTTGTTTCGTACA
>probe:Drosophila_2:1627617_at:493:689; Interrogation_Position=2626; Antisense; TATTTTGTTTCGTACACTTACCTAG
>probe:Drosophila_2:1627617_at:240:499; Interrogation_Position=2656; Antisense; GTCTAGTGCATTATTTAGTTCCCTA
>probe:Drosophila_2:1627617_at:285:689; Interrogation_Position=2708; Antisense; TATTCTAGACGTATATGCCGCTGAC
>probe:Drosophila_2:1627617_at:417:625; Interrogation_Position=2723; Antisense; TGCCGCTGACATATACTGGACATAC
>probe:Drosophila_2:1627617_at:452:655; Interrogation_Position=2754; Antisense; TAACGGACAGTTTAAGAATGCTCAT
>probe:Drosophila_2:1627617_at:455:199; Interrogation_Position=2788; Antisense; AACGAGCTCGAGTGATGATGGACCT
>probe:Drosophila_2:1627617_at:5:605; Interrogation_Position=2803; Antisense; TGATGGACCTAATTAACGCAGTTAA
>probe:Drosophila_2:1627617_at:694:221; Interrogation_Position=2922; Antisense; AAGGGCAGTTTTTGCTTGGCTGTAA
>probe:Drosophila_2:1627617_at:2:25; Interrogation_Position=3011; Antisense; ATAGATCTGTGATTCTTGAAACGGA

Paste this into a BLAST search page for me
TTCTGGCCGGCGGAGATCAGTTCTCGATCAGTTCTCCAATTCGACGATGAGAAATCGGAGGACGCCATCAACGGCCAACGGCAGTTGAAGGACACCTAGTGACACCTAGTATTTTGTTTCGTACATATTTTGTTTCGTACACTTACCTAGGTCTAGTGCATTATTTAGTTCCCTATATTCTAGACGTATATGCCGCTGACTGCCGCTGACATATACTGGACATACTAACGGACAGTTTAAGAATGCTCATAACGAGCTCGAGTGATGATGGACCTTGATGGACCTAATTAACGCAGTTAAAAGGGCAGTTTTTGCTTGGCTGTAAATAGATCTGTGATTCTTGAAACGGA

Full Affymetrix probeset data:

Annotations for 1627617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720