FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627618_at:

>probe:Drosophila_2:1627618_at:259:385; Interrogation_Position=361; Antisense; GAACATCCTGGCGAGCTGGTCAAGA
>probe:Drosophila_2:1627618_at:729:211; Interrogation_Position=382; Antisense; AAGACGGGATCTCCACATGTGGTCT
>probe:Drosophila_2:1627618_at:350:355; Interrogation_Position=423; Antisense; GCACTGGCGCTCAAACAAAACTCTA
>probe:Drosophila_2:1627618_at:115:183; Interrogation_Position=439; Antisense; AAAACTCTACCGATCGCCTTCAAGG
>probe:Drosophila_2:1627618_at:23:305; Interrogation_Position=455; Antisense; CCTTCAAGGTTTTGGCACTGGGCGA
>probe:Drosophila_2:1627618_at:429:147; Interrogation_Position=493; Antisense; ACTATAGTCACCATTCGAGCCGGAA
>probe:Drosophila_2:1627618_at:485:195; Interrogation_Position=539; Antisense; AACTGAGAAACTGCACGGCCGTGAT
>probe:Drosophila_2:1627618_at:198:527; Interrogation_Position=618; Antisense; GGGCAAGAGCTTCACACTGACGATT
>probe:Drosophila_2:1627618_at:478:609; Interrogation_Position=635; Antisense; TGACGATTGTCATCTCAACGAACCC
>probe:Drosophila_2:1627618_at:190:223; Interrogation_Position=727; Antisense; AAGGTGCGACACCAGGGATTCCATC
>probe:Drosophila_2:1627618_at:599:593; Interrogation_Position=762; Antisense; TGGGCCGCAACGTTTCGGACCGGAT
>probe:Drosophila_2:1627618_at:705:411; Interrogation_Position=779; Antisense; GACCGGATCCACTTATGGCCGGATT
>probe:Drosophila_2:1627618_at:202:465; Interrogation_Position=800; Antisense; GATTGCCCTTCAAGTTGCCAGGTAA
>probe:Drosophila_2:1627618_at:166:45; Interrogation_Position=884; Antisense; ATCGCCGCCACACTGAGAGAAATTC

Paste this into a BLAST search page for me
GAACATCCTGGCGAGCTGGTCAAGAAAGACGGGATCTCCACATGTGGTCTGCACTGGCGCTCAAACAAAACTCTAAAAACTCTACCGATCGCCTTCAAGGCCTTCAAGGTTTTGGCACTGGGCGAACTATAGTCACCATTCGAGCCGGAAAACTGAGAAACTGCACGGCCGTGATGGGCAAGAGCTTCACACTGACGATTTGACGATTGTCATCTCAACGAACCCAAGGTGCGACACCAGGGATTCCATCTGGGCCGCAACGTTTCGGACCGGATGACCGGATCCACTTATGGCCGGATTGATTGCCCTTCAAGTTGCCAGGTAAATCGCCGCCACACTGAGAGAAATTC

Full Affymetrix probeset data:

Annotations for 1627618_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720