Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627619_at:

>probe:Drosophila_2:1627619_at:178:703; Interrogation_Position=1172; Antisense; TTAGTAGGCACATAACCTCCACCAA
>probe:Drosophila_2:1627619_at:217:317; Interrogation_Position=1230; Antisense; GCCTCCAGCGGGTGCTTACAGTGTG
>probe:Drosophila_2:1627619_at:353:585; Interrogation_Position=1253; Antisense; TGGAAAGCTACGAAGAGGCCTCTGA
>probe:Drosophila_2:1627619_at:441:101; Interrogation_Position=1356; Antisense; AGACTATCAGTCTCAATTTCCCGAA
>probe:Drosophila_2:1627619_at:259:375; Interrogation_Position=1437; Antisense; GAAGAAATGCCTCTCGTGCTTTAAG
>probe:Drosophila_2:1627619_at:467:443; Interrogation_Position=1477; Antisense; GATGTTATGTCTCATGCCATTGCCG
>probe:Drosophila_2:1627619_at:673:49; Interrogation_Position=1490; Antisense; ATGCCATTGCCGAATTGACCGTCGC
>probe:Drosophila_2:1627619_at:194:413; Interrogation_Position=1506; Antisense; GACCGTCGCCGAATTGAGTATGCTG
>probe:Drosophila_2:1627619_at:195:529; Interrogation_Position=1553; Antisense; GGGTCGATACCGAACTCGCCTTGGA
>probe:Drosophila_2:1627619_at:636:309; Interrogation_Position=1578; Antisense; CCAGCTGCGCGAGGTCTTAGAGAAT
>probe:Drosophila_2:1627619_at:143:237; Interrogation_Position=1600; Antisense; AATCGCGGCGAGATTCGATCCAACA
>probe:Drosophila_2:1627619_at:579:447; Interrogation_Position=1616; Antisense; GATCCAACACCGACGACTTGATGCG
>probe:Drosophila_2:1627619_at:439:441; Interrogation_Position=1656; Antisense; GATGGAGCGTGATCTCATGCTGGCT
>probe:Drosophila_2:1627619_at:509:621; Interrogation_Position=1702; Antisense; TGCTGCGAATGCACAGTGAACTTCT

Paste this into a BLAST search page for me
TTAGTAGGCACATAACCTCCACCAAGCCTCCAGCGGGTGCTTACAGTGTGTGGAAAGCTACGAAGAGGCCTCTGAAGACTATCAGTCTCAATTTCCCGAAGAAGAAATGCCTCTCGTGCTTTAAGGATGTTATGTCTCATGCCATTGCCGATGCCATTGCCGAATTGACCGTCGCGACCGTCGCCGAATTGAGTATGCTGGGGTCGATACCGAACTCGCCTTGGACCAGCTGCGCGAGGTCTTAGAGAATAATCGCGGCGAGATTCGATCCAACAGATCCAACACCGACGACTTGATGCGGATGGAGCGTGATCTCATGCTGGCTTGCTGCGAATGCACAGTGAACTTCT

Full Affymetrix probeset data:

Annotations for 1627619_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime