FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627629_at:

>probe:Drosophila_2:1627629_at:547:681; Interrogation_Position=470; Antisense; TATGGTGAGCCCGTTTTCAAGACCC
>probe:Drosophila_2:1627629_at:169:591; Interrogation_Position=510; Antisense; TGGTCACGCCCATTTTCAAGGAGTT
>probe:Drosophila_2:1627629_at:377:15; Interrogation_Position=521; Antisense; ATTTTCAAGGAGTTCTACGCCCACT
>probe:Drosophila_2:1627629_at:678:141; Interrogation_Position=549; Antisense; ACTGGAAGTCGTACGCCAAGCGTGC
>probe:Drosophila_2:1627629_at:63:207; Interrogation_Position=566; Antisense; AAGCGTGCCCACTTGAAGCTCTGGT
>probe:Drosophila_2:1627629_at:179:377; Interrogation_Position=580; Antisense; GAAGCTCTGGTCCTAAATCGGCCTA
>probe:Drosophila_2:1627629_at:644:209; Interrogation_Position=627; Antisense; AAGCACGCACCTTTTTGTTTGTAGA
>probe:Drosophila_2:1627629_at:627:601; Interrogation_Position=642; Antisense; TGTTTGTAGATCATCCGCCTAAGCG
>probe:Drosophila_2:1627629_at:61:395; Interrogation_Position=715; Antisense; GAAATACCGATTCTCTTTGTGTGTG
>probe:Drosophila_2:1627629_at:354:517; Interrogation_Position=735; Antisense; GTGTGTTTAATCCAAATCCTGTGCT
>probe:Drosophila_2:1627629_at:724:127; Interrogation_Position=762; Antisense; ACCACCCGAGGTAGCCAGAGATTTT
>probe:Drosophila_2:1627629_at:215:501; Interrogation_Position=808; Antisense; GTCCAGCTGCAATATAGCCCACGGG
>probe:Drosophila_2:1627629_at:228:675; Interrogation_Position=822; Antisense; TAGCCCACGGGCAGTGCTCAAAAAT
>probe:Drosophila_2:1627629_at:198:565; Interrogation_Position=883; Antisense; GGAATCCCAGTTGGCTGTGTCACCA

Paste this into a BLAST search page for me
TATGGTGAGCCCGTTTTCAAGACCCTGGTCACGCCCATTTTCAAGGAGTTATTTTCAAGGAGTTCTACGCCCACTACTGGAAGTCGTACGCCAAGCGTGCAAGCGTGCCCACTTGAAGCTCTGGTGAAGCTCTGGTCCTAAATCGGCCTAAAGCACGCACCTTTTTGTTTGTAGATGTTTGTAGATCATCCGCCTAAGCGGAAATACCGATTCTCTTTGTGTGTGGTGTGTTTAATCCAAATCCTGTGCTACCACCCGAGGTAGCCAGAGATTTTGTCCAGCTGCAATATAGCCCACGGGTAGCCCACGGGCAGTGCTCAAAAATGGAATCCCAGTTGGCTGTGTCACCA

Full Affymetrix probeset data:

Annotations for 1627629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720