Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627631_s_at:

>probe:Drosophila_2:1627631_s_at:409:121; Interrogation_Position=163; Antisense; AGCGTCATCGTAAGGTGCTTCGTGA
>probe:Drosophila_2:1627631_s_at:86:533; Interrogation_Position=176; Antisense; GGTGCTTCGTGATAACATCCAGGGT
>probe:Drosophila_2:1627631_s_at:105:81; Interrogation_Position=196; Antisense; AGGGTATCACCAAGCCTGCTATTCG
>probe:Drosophila_2:1627631_s_at:498:287; Interrogation_Position=236; Antisense; CGGCGGTGTTAAGCGTATCTCTGGC
>probe:Drosophila_2:1627631_s_at:452:483; Interrogation_Position=250; Antisense; GTATCTCTGGCTTGATTTACGAGGA
>probe:Drosophila_2:1627631_s_at:257:383; Interrogation_Position=273; Antisense; GAAACTCGCGGTGTGCTAAAGGTAT
>probe:Drosophila_2:1627631_s_at:511:533; Interrogation_Position=293; Antisense; GGTATTCCTTGAGAACGTTATCCGT
>probe:Drosophila_2:1627631_s_at:33:109; Interrogation_Position=304; Antisense; AGAACGTTATCCGTGACGCTGTCAC
>probe:Drosophila_2:1627631_s_at:665:359; Interrogation_Position=349; Antisense; GCAAGACCGTGACCGCCATGGACGT
>probe:Drosophila_2:1627631_s_at:218:67; Interrogation_Position=366; Antisense; ATGGACGTGGTCTATGCCCTCAAGC
>probe:Drosophila_2:1627631_s_at:705:265; Interrogation_Position=393; Antisense; CAGGGACGCACCCTTTACGGATTTG
>probe:Drosophila_2:1627631_s_at:454:543; Interrogation_Position=411; Antisense; GGATTTGGCGGTTAAGCACGCCCTC
>probe:Drosophila_2:1627631_s_at:55:321; Interrogation_Position=430; Antisense; GCCCTCTAACCTCCACATAATAAAT
>probe:Drosophila_2:1627631_s_at:32:711; Interrogation_Position=518; Antisense; TTCAACGCAAACTTAACCGAACGCA

Paste this into a BLAST search page for me
AGCGTCATCGTAAGGTGCTTCGTGAGGTGCTTCGTGATAACATCCAGGGTAGGGTATCACCAAGCCTGCTATTCGCGGCGGTGTTAAGCGTATCTCTGGCGTATCTCTGGCTTGATTTACGAGGAGAAACTCGCGGTGTGCTAAAGGTATGGTATTCCTTGAGAACGTTATCCGTAGAACGTTATCCGTGACGCTGTCACGCAAGACCGTGACCGCCATGGACGTATGGACGTGGTCTATGCCCTCAAGCCAGGGACGCACCCTTTACGGATTTGGGATTTGGCGGTTAAGCACGCCCTCGCCCTCTAACCTCCACATAATAAATTTCAACGCAAACTTAACCGAACGCA

Full Affymetrix probeset data:

Annotations for 1627631_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime