FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627632_at:

>probe:Drosophila_2:1627632_at:599:271; Interrogation_Position=105; Antisense; CATCTACGGGTTCGGCCACGGCTAT
>probe:Drosophila_2:1627632_at:311:455; Interrogation_Position=152; Antisense; GATACGGTGCCTATGGACACGGTCA
>probe:Drosophila_2:1627632_at:149:113; Interrogation_Position=16; Antisense; AGCACCTGGGCAGCAGTTTCGGAGC
>probe:Drosophila_2:1627632_at:38:67; Interrogation_Position=164; Antisense; ATGGACACGGTCACTACGGCGGCTA
>probe:Drosophila_2:1627632_at:470:257; Interrogation_Position=175; Antisense; CACTACGGCGGCTACGGTGGACTGA
>probe:Drosophila_2:1627632_at:688:555; Interrogation_Position=193; Antisense; GGACTGAGCAGTCCCTACTACGGCG
>probe:Drosophila_2:1627632_at:295:141; Interrogation_Position=212; Antisense; ACGGCGGCTACGGATACGTCCATGC
>probe:Drosophila_2:1627632_at:400:139; Interrogation_Position=221; Antisense; ACGGATACGTCCATGCGGCGCCCTA
>probe:Drosophila_2:1627632_at:638:669; Interrogation_Position=247; Antisense; TACGGCGGACACCACGGCTACTATC
>probe:Drosophila_2:1627632_at:524:129; Interrogation_Position=278; Antisense; ACCATGGCCACTACGGCTTCTACTA
>probe:Drosophila_2:1627632_at:150:555; Interrogation_Position=36; Antisense; GGAGCCTGCTCCTGAAGCTCTGGAG
>probe:Drosophila_2:1627632_at:656:283; Interrogation_Position=47; Antisense; CTGAAGCTCTGGAGCCGGAGCCATC
>probe:Drosophila_2:1627632_at:549:415; Interrogation_Position=64; Antisense; GAGCCATCCGCCGTGGATGAGAAGA
>probe:Drosophila_2:1627632_at:169:101; Interrogation_Position=98; Antisense; AGAGAGGCATCTACGGGTTCGGCCA

Paste this into a BLAST search page for me
CATCTACGGGTTCGGCCACGGCTATGATACGGTGCCTATGGACACGGTCAAGCACCTGGGCAGCAGTTTCGGAGCATGGACACGGTCACTACGGCGGCTACACTACGGCGGCTACGGTGGACTGAGGACTGAGCAGTCCCTACTACGGCGACGGCGGCTACGGATACGTCCATGCACGGATACGTCCATGCGGCGCCCTATACGGCGGACACCACGGCTACTATCACCATGGCCACTACGGCTTCTACTAGGAGCCTGCTCCTGAAGCTCTGGAGCTGAAGCTCTGGAGCCGGAGCCATCGAGCCATCCGCCGTGGATGAGAAGAAGAGAGGCATCTACGGGTTCGGCCA

Full Affymetrix probeset data:

Annotations for 1627632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720