FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627633_at:

>probe:Drosophila_2:1627633_at:294:647; Interrogation_Position=280; Antisense; TCATTTCCTGGAATTGCCGGCATGT
>probe:Drosophila_2:1627633_at:555:539; Interrogation_Position=349; Antisense; GGTATGAATTCCCTATCTGCTGTTT
>probe:Drosophila_2:1627633_at:449:435; Interrogation_Position=379; Antisense; GAGGATTACATTAAGCCCCTTGCGA
>probe:Drosophila_2:1627633_at:40:361; Interrogation_Position=402; Antisense; GAAGAAACCCCTTACGGAACATCAG
>probe:Drosophila_2:1627633_at:512:301; Interrogation_Position=479; Antisense; CCCTGGTCTTTGTGGTCGAGCGGAT
>probe:Drosophila_2:1627633_at:671:121; Interrogation_Position=497; Antisense; AGCGGATGAGCTCCCATGTGTTGCA
>probe:Drosophila_2:1627633_at:533:63; Interrogation_Position=512; Antisense; ATGTGTTGCAACTCGGCATCGCCAT
>probe:Drosophila_2:1627633_at:398:45; Interrogation_Position=529; Antisense; ATCGCCATTGGTTCAGTGGTCCAAG
>probe:Drosophila_2:1627633_at:460:711; Interrogation_Position=560; Antisense; TTCTTGGTCTGTTTTCGATGGGTCT
>probe:Drosophila_2:1627633_at:118:249; Interrogation_Position=626; Antisense; CAATTTTTGGCTTCTTCTTCATGGG
>probe:Drosophila_2:1627633_at:237:481; Interrogation_Position=659; Antisense; GTATTTCGGCCCAAATTGCCATTAA
>probe:Drosophila_2:1627633_at:508:461; Interrogation_Position=733; Antisense; GATTATGAGTTCGACCGTTCTCTGC
>probe:Drosophila_2:1627633_at:443:293; Interrogation_Position=748; Antisense; CGTTCTCTGCTGACATCTGCAAATG
>probe:Drosophila_2:1627633_at:60:631; Interrogation_Position=793; Antisense; TCCGCGTAAGTTTGCGATATCCTTA

Paste this into a BLAST search page for me
TCATTTCCTGGAATTGCCGGCATGTGGTATGAATTCCCTATCTGCTGTTTGAGGATTACATTAAGCCCCTTGCGAGAAGAAACCCCTTACGGAACATCAGCCCTGGTCTTTGTGGTCGAGCGGATAGCGGATGAGCTCCCATGTGTTGCAATGTGTTGCAACTCGGCATCGCCATATCGCCATTGGTTCAGTGGTCCAAGTTCTTGGTCTGTTTTCGATGGGTCTCAATTTTTGGCTTCTTCTTCATGGGGTATTTCGGCCCAAATTGCCATTAAGATTATGAGTTCGACCGTTCTCTGCCGTTCTCTGCTGACATCTGCAAATGTCCGCGTAAGTTTGCGATATCCTTA

Full Affymetrix probeset data:

Annotations for 1627633_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720