FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627634_at:

>probe:Drosophila_2:1627634_at:270:729; Interrogation_Position=205; Antisense; TTGGCCCTCGGATTCGTCGATGAAA
>probe:Drosophila_2:1627634_at:282:463; Interrogation_Position=259; Antisense; GATTCTAACAAGACGGCCACCGAGA
>probe:Drosophila_2:1627634_at:228:313; Interrogation_Position=274; Antisense; GCCACCGAGATTCGCAGTGTGCTAA
>probe:Drosophila_2:1627634_at:679:513; Interrogation_Position=290; Antisense; GTGTGCTAATCATCGTTTTCAGTGT
>probe:Drosophila_2:1627634_at:264:79; Interrogation_Position=329; Antisense; AGGTGATTAATCTTCTGGCTTCGGC
>probe:Drosophila_2:1627634_at:44:315; Interrogation_Position=352; Antisense; GCCATGTTGGTTGCAGGTACCGTTA
>probe:Drosophila_2:1627634_at:192:655; Interrogation_Position=375; Antisense; TAAGGAACGCCATTTACTCCTGCTG
>probe:Drosophila_2:1627634_at:220:337; Interrogation_Position=396; Antisense; GCTGCCCTGGCTGATCAACAATGGA
>probe:Drosophila_2:1627634_at:290:433; Interrogation_Position=419; Antisense; GAGTGCTGCTTGTCTTTGGAATTAT
>probe:Drosophila_2:1627634_at:173:53; Interrogation_Position=457; Antisense; ATGCTGGCCCAGATCATCGGAAATA
>probe:Drosophila_2:1627634_at:139:165; Interrogation_Position=477; Antisense; AAATACATCTTTCCTGAGCGCTCTT
>probe:Drosophila_2:1627634_at:29:611; Interrogation_Position=536; Antisense; TGACCTGGTATCTCTACTACGGCAT
>probe:Drosophila_2:1627634_at:276:115; Interrogation_Position=575; Antisense; AGCAGATCCAGGCATCCCGTGAGAT
>probe:Drosophila_2:1627634_at:377:581; Interrogation_Position=688; Antisense; TGGCCAGCTCTTATTTCATCATATC

Paste this into a BLAST search page for me
TTGGCCCTCGGATTCGTCGATGAAAGATTCTAACAAGACGGCCACCGAGAGCCACCGAGATTCGCAGTGTGCTAAGTGTGCTAATCATCGTTTTCAGTGTAGGTGATTAATCTTCTGGCTTCGGCGCCATGTTGGTTGCAGGTACCGTTATAAGGAACGCCATTTACTCCTGCTGGCTGCCCTGGCTGATCAACAATGGAGAGTGCTGCTTGTCTTTGGAATTATATGCTGGCCCAGATCATCGGAAATAAAATACATCTTTCCTGAGCGCTCTTTGACCTGGTATCTCTACTACGGCATAGCAGATCCAGGCATCCCGTGAGATTGGCCAGCTCTTATTTCATCATATC

Full Affymetrix probeset data:

Annotations for 1627634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720