Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627636_at:

>probe:Drosophila_2:1627636_at:238:665; Interrogation_Position=1036; Antisense; TACAACTCGCTACCGCAAAAGTCTA
>probe:Drosophila_2:1627636_at:397:663; Interrogation_Position=1059; Antisense; TAAATACGTGACCTACTTGCCACAC
>probe:Drosophila_2:1627636_at:612:175; Interrogation_Position=1145; Antisense; AAACTGGCGGCCACGGGAGTCCACA
>probe:Drosophila_2:1627636_at:271:41; Interrogation_Position=1180; Antisense; ATCGGCCACGGCATCCAAAGTGTTG
>probe:Drosophila_2:1627636_at:419:169; Interrogation_Position=1196; Antisense; AAAGTGTTGTAGAAGGCCCCGCTGT
>probe:Drosophila_2:1627636_at:255:577; Interrogation_Position=1210; Antisense; GGCCCCGCTGTAACGCTAATCGAGG
>probe:Drosophila_2:1627636_at:223:81; Interrogation_Position=1265; Antisense; AGGTGAAGACCTGGCGCAATGCTCG
>probe:Drosophila_2:1627636_at:621:231; Interrogation_Position=1282; Antisense; AATGCTCGCGTCCTGAACAATCAGT
>probe:Drosophila_2:1627636_at:224:161; Interrogation_Position=1298; Antisense; ACAATCAGTTGGTGCCATATCCAGA
>probe:Drosophila_2:1627636_at:598:23; Interrogation_Position=1314; Antisense; ATATCCAGAGGGTTACACGCCGCCA
>probe:Drosophila_2:1627636_at:418:97; Interrogation_Position=1346; Antisense; AGATGCCCAGTTTCGACCGATAGGT
>probe:Drosophila_2:1627636_at:576:379; Interrogation_Position=1384; Antisense; GAACCACTGGTGTTTGGTGCTCAAC
>probe:Drosophila_2:1627636_at:576:317; Interrogation_Position=925; Antisense; GCCGCTTCCGACATACAGGAGTACT
>probe:Drosophila_2:1627636_at:339:523; Interrogation_Position=971; Antisense; GGGCCTATATCAGCAGTGTGTCCAA

Paste this into a BLAST search page for me
TACAACTCGCTACCGCAAAAGTCTATAAATACGTGACCTACTTGCCACACAAACTGGCGGCCACGGGAGTCCACAATCGGCCACGGCATCCAAAGTGTTGAAAGTGTTGTAGAAGGCCCCGCTGTGGCCCCGCTGTAACGCTAATCGAGGAGGTGAAGACCTGGCGCAATGCTCGAATGCTCGCGTCCTGAACAATCAGTACAATCAGTTGGTGCCATATCCAGAATATCCAGAGGGTTACACGCCGCCAAGATGCCCAGTTTCGACCGATAGGTGAACCACTGGTGTTTGGTGCTCAACGCCGCTTCCGACATACAGGAGTACTGGGCCTATATCAGCAGTGTGTCCAA

Full Affymetrix probeset data:

Annotations for 1627636_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime