Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627637_at:

>probe:Drosophila_2:1627637_at:47:273; Interrogation_Position=3754; Antisense; CTTCCAGTTCATGACGCTCAGTAAA
>probe:Drosophila_2:1627637_at:243:403; Interrogation_Position=3783; Antisense; GACTACTGGTGGAAACAAACTGGTT
>probe:Drosophila_2:1627637_at:346:463; Interrogation_Position=3810; Antisense; GATTCCATTCATTCCATCTGTTCAA
>probe:Drosophila_2:1627637_at:422:271; Interrogation_Position=3824; Antisense; CATCTGTTCAACTCTTCCTGATTTT
>probe:Drosophila_2:1627637_at:133:629; Interrogation_Position=3839; Antisense; TCCTGATTTTAGACATCCCATTTCT
>probe:Drosophila_2:1627637_at:68:209; Interrogation_Position=3902; Antisense; AAGCATTCTGTCTACGAAGCGCATG
>probe:Drosophila_2:1627637_at:668:205; Interrogation_Position=3918; Antisense; AAGCGCATGCTAACTGAGGTGCTCT
>probe:Drosophila_2:1627637_at:582:607; Interrogation_Position=3932; Antisense; TGAGGTGCTCTAATTGGCCCCTAAC
>probe:Drosophila_2:1627637_at:109:537; Interrogation_Position=3946; Antisense; TGGCCCCTAACTTACGTAGTATTAT
>probe:Drosophila_2:1627637_at:143:135; Interrogation_Position=3992; Antisense; ACGCCAATCGATAGGTTGTAGCTTC
>probe:Drosophila_2:1627637_at:295:487; Interrogation_Position=4009; Antisense; GTAGCTTCAATTACATACCCACAAG
>probe:Drosophila_2:1627637_at:692:29; Interrogation_Position=4044; Antisense; ATAAGTTCTTCCACCTAATTCATAA
>probe:Drosophila_2:1627637_at:509:285; Interrogation_Position=4084; Antisense; CTGAGATTACATTATTCGCCGTTAA
>probe:Drosophila_2:1627637_at:378:147; Interrogation_Position=4187; Antisense; ACTAAGGTTCATTTTGTCATTCAAA

Paste this into a BLAST search page for me
CTTCCAGTTCATGACGCTCAGTAAAGACTACTGGTGGAAACAAACTGGTTGATTCCATTCATTCCATCTGTTCAACATCTGTTCAACTCTTCCTGATTTTTCCTGATTTTAGACATCCCATTTCTAAGCATTCTGTCTACGAAGCGCATGAAGCGCATGCTAACTGAGGTGCTCTTGAGGTGCTCTAATTGGCCCCTAACTGGCCCCTAACTTACGTAGTATTATACGCCAATCGATAGGTTGTAGCTTCGTAGCTTCAATTACATACCCACAAGATAAGTTCTTCCACCTAATTCATAACTGAGATTACATTATTCGCCGTTAAACTAAGGTTCATTTTGTCATTCAAA

Full Affymetrix probeset data:

Annotations for 1627637_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime