FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627640_at:

>probe:Drosophila_2:1627640_at:49:287; Interrogation_Position=1091; Antisense; CTGGATCCGCGTGAATACGGCTTTG
>probe:Drosophila_2:1627640_at:652:27; Interrogation_Position=1105; Antisense; ATACGGCTTTGTCGTGGATACCAAG
>probe:Drosophila_2:1627640_at:593:291; Interrogation_Position=1117; Antisense; CGTGGATACCAAGCCGGACTCTGTG
>probe:Drosophila_2:1627640_at:493:617; Interrogation_Position=1148; Antisense; TGCATTCTGAGCGACTTTCTCTACC
>probe:Drosophila_2:1627640_at:720:649; Interrogation_Position=1225; Antisense; TCACATCCTGAGTGTCGGCATACAG
>probe:Drosophila_2:1627640_at:435:549; Interrogation_Position=1260; Antisense; TGGAGTGGCCCTTACCCGTAAATTG
>probe:Drosophila_2:1627640_at:623:161; Interrogation_Position=1279; Antisense; AAATTGTACATTTTTGCCCTGCCTG
>probe:Drosophila_2:1627640_at:532:589; Interrogation_Position=1302; Antisense; TGGATCTGCCGGAAACCAACCTGAT
>probe:Drosophila_2:1627640_at:539:37; Interrogation_Position=1334; Antisense; ATCTTGCCCGCGTCAATGGAGTTTA
>probe:Drosophila_2:1627640_at:245:155; Interrogation_Position=1371; Antisense; ACAGATCGCAGGGTTGCGTGCTCGT
>probe:Drosophila_2:1627640_at:17:541; Interrogation_Position=1439; Antisense; GGTTATTTAATGCAGCGCCGTGACA
>probe:Drosophila_2:1627640_at:386:321; Interrogation_Position=1453; Antisense; GCGCCGTGACATGTGCTACGAAGAT
>probe:Drosophila_2:1627640_at:558:551; Interrogation_Position=1500; Antisense; GGAGACCGTGTATTCAGCCCAATGC
>probe:Drosophila_2:1627640_at:193:125; Interrogation_Position=1515; Antisense; AGCCCAATGCGGGATTCATACAACA

Paste this into a BLAST search page for me
CTGGATCCGCGTGAATACGGCTTTGATACGGCTTTGTCGTGGATACCAAGCGTGGATACCAAGCCGGACTCTGTGTGCATTCTGAGCGACTTTCTCTACCTCACATCCTGAGTGTCGGCATACAGTGGAGTGGCCCTTACCCGTAAATTGAAATTGTACATTTTTGCCCTGCCTGTGGATCTGCCGGAAACCAACCTGATATCTTGCCCGCGTCAATGGAGTTTAACAGATCGCAGGGTTGCGTGCTCGTGGTTATTTAATGCAGCGCCGTGACAGCGCCGTGACATGTGCTACGAAGATGGAGACCGTGTATTCAGCCCAATGCAGCCCAATGCGGGATTCATACAACA

Full Affymetrix probeset data:

Annotations for 1627640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720