FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627643_at:

>probe:Drosophila_2:1627643_at:461:3; Interrogation_Position=111; Antisense; ATTGATACTCAAGATCTTCGCCGCT
>probe:Drosophila_2:1627643_at:60:97; Interrogation_Position=122; Antisense; AGATCTTCGCCGCTGGTATTTACAC
>probe:Drosophila_2:1627643_at:642:265; Interrogation_Position=13; Antisense; CAGTATGCAAGTGCACCTGCAGCTA
>probe:Drosophila_2:1627643_at:590:291; Interrogation_Position=133; Antisense; GCTGGTATTTACACGGGTCTCATGC
>probe:Drosophila_2:1627643_at:58:667; Interrogation_Position=142; Antisense; TACACGGGTCTCATGCGCTTCTTTA
>probe:Drosophila_2:1627643_at:270:647; Interrogation_Position=152; Antisense; TCATGCGCTTCTTTACGGCCACCTT
>probe:Drosophila_2:1627643_at:646:509; Interrogation_Position=23; Antisense; GTGCACCTGCAGCTATCAAAATGCT
>probe:Drosophila_2:1627643_at:391:31; Interrogation_Position=37; Antisense; ATCAAAATGCTTAACCCCGAACTCA
>probe:Drosophila_2:1627643_at:420:707; Interrogation_Position=47; Antisense; TTAACCCCGAACTCATGTCGCTGGA
>probe:Drosophila_2:1627643_at:503:303; Interrogation_Position=53; Antisense; CCGAACTCATGTCGCTGGAGAACCA
>probe:Drosophila_2:1627643_at:430:423; Interrogation_Position=70; Antisense; GAGAACCAGGTGTTCCGATGCTACC
>probe:Drosophila_2:1627643_at:386:81; Interrogation_Position=77; Antisense; AGGTGTTCCGATGCTACCTGGGATG
>probe:Drosophila_2:1627643_at:467:51; Interrogation_Position=87; Antisense; ATGCTACCTGGGATGGTCGGCTATA
>probe:Drosophila_2:1627643_at:240:547; Interrogation_Position=97; Antisense; GGATGGTCGGCTATATTGATACTCA

Paste this into a BLAST search page for me
ATTGATACTCAAGATCTTCGCCGCTAGATCTTCGCCGCTGGTATTTACACCAGTATGCAAGTGCACCTGCAGCTAGCTGGTATTTACACGGGTCTCATGCTACACGGGTCTCATGCGCTTCTTTATCATGCGCTTCTTTACGGCCACCTTGTGCACCTGCAGCTATCAAAATGCTATCAAAATGCTTAACCCCGAACTCATTAACCCCGAACTCATGTCGCTGGACCGAACTCATGTCGCTGGAGAACCAGAGAACCAGGTGTTCCGATGCTACCAGGTGTTCCGATGCTACCTGGGATGATGCTACCTGGGATGGTCGGCTATAGGATGGTCGGCTATATTGATACTCA

Full Affymetrix probeset data:

Annotations for 1627643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720