FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627645_at:

>probe:Drosophila_2:1627645_at:424:505; Interrogation_Position=273; Antisense; GTGCCCGGACAGCAGGAACTTCATG
>probe:Drosophila_2:1627645_at:473:647; Interrogation_Position=293; Antisense; TCATGCATCAGCTAGGACCCGTTTA
>probe:Drosophila_2:1627645_at:83:723; Interrogation_Position=338; Antisense; TTGATATACTCTTAGTGCCCTTCGG
>probe:Drosophila_2:1627645_at:440:507; Interrogation_Position=352; Antisense; GTGCCCTTCGGAAAATCGCAGTCGG
>probe:Drosophila_2:1627645_at:328:89; Interrogation_Position=371; Antisense; AGTCGGAGCGCAATGGTGCCATCTT
>probe:Drosophila_2:1627645_at:730:431; Interrogation_Position=418; Antisense; GAGTGCAAGGGCAATCGCCTCCAGA
>probe:Drosophila_2:1627645_at:660:315; Interrogation_Position=434; Antisense; GCCTCCAGAGTTGCGTCATCAACAG
>probe:Drosophila_2:1627645_at:93:507; Interrogation_Position=495; Antisense; GTGCCAGATGCTAGCTCCGGATTAT
>probe:Drosophila_2:1627645_at:399:543; Interrogation_Position=513; Antisense; GGATTATTCCCGCATTGATCAGTGT
>probe:Drosophila_2:1627645_at:711:71; Interrogation_Position=545; Antisense; AGGCAGGCCTGCTCACCGATGTGGT
>probe:Drosophila_2:1627645_at:169:105; Interrogation_Position=587; Antisense; AGACGGGCACCAAATTGCAGCTGCA
>probe:Drosophila_2:1627645_at:663:609; Interrogation_Position=623; Antisense; TGACCAAACAGTACAGCCCGAGCTT
>probe:Drosophila_2:1627645_at:264:633; Interrogation_Position=713; Antisense; TCCGCGGCACGGTTTGTTATATGTT
>probe:Drosophila_2:1627645_at:393:469; Interrogation_Position=735; Antisense; GTTGCGTCAACAAAACTTGCTGCCC

Paste this into a BLAST search page for me
GTGCCCGGACAGCAGGAACTTCATGTCATGCATCAGCTAGGACCCGTTTATTGATATACTCTTAGTGCCCTTCGGGTGCCCTTCGGAAAATCGCAGTCGGAGTCGGAGCGCAATGGTGCCATCTTGAGTGCAAGGGCAATCGCCTCCAGAGCCTCCAGAGTTGCGTCATCAACAGGTGCCAGATGCTAGCTCCGGATTATGGATTATTCCCGCATTGATCAGTGTAGGCAGGCCTGCTCACCGATGTGGTAGACGGGCACCAAATTGCAGCTGCATGACCAAACAGTACAGCCCGAGCTTTCCGCGGCACGGTTTGTTATATGTTGTTGCGTCAACAAAACTTGCTGCCC

Full Affymetrix probeset data:

Annotations for 1627645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720