FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627646_at:

>probe:Drosophila_2:1627646_at:220:723; Interrogation_Position=310; Antisense; TTGCAACCACAAGATCTTTGAACTT
>probe:Drosophila_2:1627646_at:128:385; Interrogation_Position=329; Antisense; GAACTTCAAAAACGCTTCGAATCGG
>probe:Drosophila_2:1627646_at:35:183; Interrogation_Position=337; Antisense; AAAACGCTTCGAATCGGCACGCGAG
>probe:Drosophila_2:1627646_at:43:343; Interrogation_Position=342; Antisense; GCTTCGAATCGGCACGCGAGCAAAT
>probe:Drosophila_2:1627646_at:723:237; Interrogation_Position=348; Antisense; AATCGGCACGCGAGCAAATCCGCCA
>probe:Drosophila_2:1627646_at:301:263; Interrogation_Position=371; Antisense; CAGCTCCCCGGGATCGATTTCAATA
>probe:Drosophila_2:1627646_at:617:101; Interrogation_Position=411; Antisense; AGAGACTGGAACTACTGCGAAATCA
>probe:Drosophila_2:1627646_at:677:141; Interrogation_Position=415; Antisense; ACTGGAACTACTGCGAAATCAGCTG
>probe:Drosophila_2:1627646_at:184:325; Interrogation_Position=427; Antisense; GCGAAATCAGCTGAAGCTTAAGCAG
>probe:Drosophila_2:1627646_at:677:341; Interrogation_Position=442; Antisense; GCTTAAGCAGCAGCTAATTCGCAAA
>probe:Drosophila_2:1627646_at:182:353; Interrogation_Position=448; Antisense; GCAGCAGCTAATTCGCAAATACAAG
>probe:Drosophila_2:1627646_at:67:719; Interrogation_Position=459; Antisense; TTCGCAAATACAAGGACACAGAGTT
>probe:Drosophila_2:1627646_at:530:157; Interrogation_Position=474; Antisense; ACACAGAGTTCTAGGCGGCAGCAAA
>probe:Drosophila_2:1627646_at:726:87; Interrogation_Position=480; Antisense; AGTTCTAGGCGGCAGCAAAATAAAA

Paste this into a BLAST search page for me
TTGCAACCACAAGATCTTTGAACTTGAACTTCAAAAACGCTTCGAATCGGAAAACGCTTCGAATCGGCACGCGAGGCTTCGAATCGGCACGCGAGCAAATAATCGGCACGCGAGCAAATCCGCCACAGCTCCCCGGGATCGATTTCAATAAGAGACTGGAACTACTGCGAAATCAACTGGAACTACTGCGAAATCAGCTGGCGAAATCAGCTGAAGCTTAAGCAGGCTTAAGCAGCAGCTAATTCGCAAAGCAGCAGCTAATTCGCAAATACAAGTTCGCAAATACAAGGACACAGAGTTACACAGAGTTCTAGGCGGCAGCAAAAGTTCTAGGCGGCAGCAAAATAAAA

Full Affymetrix probeset data:

Annotations for 1627646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720