Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627647_at:

>probe:Drosophila_2:1627647_at:149:435; Interrogation_Position=1000; Antisense; GAGGGCAAGCAGCTGCACAACAACT
>probe:Drosophila_2:1627647_at:138:181; Interrogation_Position=1044; Antisense; AAACAATCGAGCTGTGGTCCTGGTC
>probe:Drosophila_2:1627647_at:272:505; Interrogation_Position=1060; Antisense; GTCCTGGTCGAGCAACCTGAGCAGA
>probe:Drosophila_2:1627647_at:648:649; Interrogation_Position=1093; Antisense; TCAGCAGGACTCACTGCATCCGTAT
>probe:Drosophila_2:1627647_at:408:347; Interrogation_Position=1108; Antisense; GCATCCGTATCCTTGGGCCTGATGA
>probe:Drosophila_2:1627647_at:682:521; Interrogation_Position=1146; Antisense; GGGCCAGAAGTTCCTGCTTTAGATT
>probe:Drosophila_2:1627647_at:300:559; Interrogation_Position=1177; Antisense; GGACAACTTGAAGGGAGCAGCCAAT
>probe:Drosophila_2:1627647_at:349:353; Interrogation_Position=1193; Antisense; GCAGCCAATGACATACTCGTACCAA
>probe:Drosophila_2:1627647_at:79:159; Interrogation_Position=1284; Antisense; ACACAGGAGAGCAACGTCAGACCAG
>probe:Drosophila_2:1627647_at:635:495; Interrogation_Position=1299; Antisense; GTCAGACCAGACAATTTATACTCAT
>probe:Drosophila_2:1627647_at:329:363; Interrogation_Position=1348; Antisense; GAATTCAGCTAGTCAGTTTGTGTAA
>probe:Drosophila_2:1627647_at:230:463; Interrogation_Position=832; Antisense; GATTCCCTGGCAGTGGATGACCTGG
>probe:Drosophila_2:1627647_at:256:507; Interrogation_Position=856; Antisense; GTGCCCAGTGTGGAGAACTACTTCA
>probe:Drosophila_2:1627647_at:416:65; Interrogation_Position=927; Antisense; ATGGATTGTGCTGACCGAGACCTTC

Paste this into a BLAST search page for me
GAGGGCAAGCAGCTGCACAACAACTAAACAATCGAGCTGTGGTCCTGGTCGTCCTGGTCGAGCAACCTGAGCAGATCAGCAGGACTCACTGCATCCGTATGCATCCGTATCCTTGGGCCTGATGAGGGCCAGAAGTTCCTGCTTTAGATTGGACAACTTGAAGGGAGCAGCCAATGCAGCCAATGACATACTCGTACCAAACACAGGAGAGCAACGTCAGACCAGGTCAGACCAGACAATTTATACTCATGAATTCAGCTAGTCAGTTTGTGTAAGATTCCCTGGCAGTGGATGACCTGGGTGCCCAGTGTGGAGAACTACTTCAATGGATTGTGCTGACCGAGACCTTC

Full Affymetrix probeset data:

Annotations for 1627647_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime