FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627648_at:

>probe:Drosophila_2:1627648_at:465:311; Interrogation_Position=109; Antisense; GCCAAGCTATTCAAGCCCAATGATT
>probe:Drosophila_2:1627648_at:627:363; Interrogation_Position=172; Antisense; GAATTCGTGCAGAATCCATCGTCTT
>probe:Drosophila_2:1627648_at:596:719; Interrogation_Position=195; Antisense; TTCCCTGTACAGTGCATTCAACCAA
>probe:Drosophila_2:1627648_at:229:209; Interrogation_Position=23; Antisense; AAGTAGCCCGCAGCTTTAACTTGGC
>probe:Drosophila_2:1627648_at:609:127; Interrogation_Position=254; Antisense; ACCAGAAGCCCGTGGTGGTTCTTGA
>probe:Drosophila_2:1627648_at:241:283; Interrogation_Position=273; Antisense; TCTTGACCCCTTTGGTAACATTACA
>probe:Drosophila_2:1627648_at:520:661; Interrogation_Position=288; Antisense; TAACATTACATTCACCCTGGGCTGG
>probe:Drosophila_2:1627648_at:159:589; Interrogation_Position=310; Antisense; TGGTCAGCCAACCTGGGAGTGTTCA
>probe:Drosophila_2:1627648_at:252:549; Interrogation_Position=325; Antisense; GGAGTGTTCAATAGCATCAGTTTCA
>probe:Drosophila_2:1627648_at:99:35; Interrogation_Position=340; Antisense; ATCAGTTTCAGCAAGAGTCGGAGTC
>probe:Drosophila_2:1627648_at:314:425; Interrogation_Position=354; Antisense; GAGTCGGAGTCTGGTTAACTACAAT
>probe:Drosophila_2:1627648_at:304:277; Interrogation_Position=372; Antisense; CTACAATGGCTGGACTAAGGGTTAA
>probe:Drosophila_2:1627648_at:642:433; Interrogation_Position=49; Antisense; GAGGATTCATTTTACCAGGAACCAG
>probe:Drosophila_2:1627648_at:111:463; Interrogation_Position=87; Antisense; GATTCAGTTCATCGAAGACCCCGCC

Paste this into a BLAST search page for me
GCCAAGCTATTCAAGCCCAATGATTGAATTCGTGCAGAATCCATCGTCTTTTCCCTGTACAGTGCATTCAACCAAAAGTAGCCCGCAGCTTTAACTTGGCACCAGAAGCCCGTGGTGGTTCTTGATCTTGACCCCTTTGGTAACATTACATAACATTACATTCACCCTGGGCTGGTGGTCAGCCAACCTGGGAGTGTTCAGGAGTGTTCAATAGCATCAGTTTCAATCAGTTTCAGCAAGAGTCGGAGTCGAGTCGGAGTCTGGTTAACTACAATCTACAATGGCTGGACTAAGGGTTAAGAGGATTCATTTTACCAGGAACCAGGATTCAGTTCATCGAAGACCCCGCC

Full Affymetrix probeset data:

Annotations for 1627648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720