FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627652_at:

>probe:Drosophila_2:1627652_at:166:245; Interrogation_Position=103; Antisense; AATTTGCTCGACAACCGCCAATCGG
>probe:Drosophila_2:1627652_at:722:237; Interrogation_Position=122; Antisense; AATCGGCATCCGAATCCAACCAGGT
>probe:Drosophila_2:1627652_at:427:53; Interrogation_Position=13; Antisense; ATGCAGCGGTGTCCCTACATTCATG
>probe:Drosophila_2:1627652_at:130:369; Interrogation_Position=133; Antisense; GAATCCAACCAGGTCGGCACTGTGG
>probe:Drosophila_2:1627652_at:112:207; Interrogation_Position=160; Antisense; AAGCTGCAGGGCGATGGCTATCACA
>probe:Drosophila_2:1627652_at:503:325; Interrogation_Position=170; Antisense; GCGATGGCTATCACACGAGTCCTGC
>probe:Drosophila_2:1627652_at:603:121; Interrogation_Position=200; Antisense; AGCGTACTCCACTAGTGCCGCACGA
>probe:Drosophila_2:1627652_at:406:451; Interrogation_Position=223; Antisense; GATCTCGGCGAGGACTTCAATTTGG
>probe:Drosophila_2:1627652_at:550:503; Interrogation_Position=23; Antisense; GTCCCTACATTCATGAGATGCGCGA
>probe:Drosophila_2:1627652_at:67:729; Interrogation_Position=244; Antisense; TTGGATTTCGACGACGACTTCCCGA
>probe:Drosophila_2:1627652_at:361:87; Interrogation_Position=38; Antisense; AGATGCGCGAAAGATTACTGGACCA
>probe:Drosophila_2:1627652_at:581:171; Interrogation_Position=47; Antisense; AAAGATTACTGGACCAGCCGCGGGA
>probe:Drosophila_2:1627652_at:425:319; Interrogation_Position=63; Antisense; GCCGCGGGAGACACTTCAACTGGAG
>probe:Drosophila_2:1627652_at:729:65; Interrogation_Position=91; Antisense; ATGGAGCGGGCCAATTTGCTCGACA

Paste this into a BLAST search page for me
AATTTGCTCGACAACCGCCAATCGGAATCGGCATCCGAATCCAACCAGGTATGCAGCGGTGTCCCTACATTCATGGAATCCAACCAGGTCGGCACTGTGGAAGCTGCAGGGCGATGGCTATCACAGCGATGGCTATCACACGAGTCCTGCAGCGTACTCCACTAGTGCCGCACGAGATCTCGGCGAGGACTTCAATTTGGGTCCCTACATTCATGAGATGCGCGATTGGATTTCGACGACGACTTCCCGAAGATGCGCGAAAGATTACTGGACCAAAAGATTACTGGACCAGCCGCGGGAGCCGCGGGAGACACTTCAACTGGAGATGGAGCGGGCCAATTTGCTCGACA

Full Affymetrix probeset data:

Annotations for 1627652_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720