Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627653_at:

>probe:Drosophila_2:1627653_at:484:535; Interrogation_Position=1180; Antisense; GGTGCCGCACAACGAGAAGGATATT
>probe:Drosophila_2:1627653_at:567:21; Interrogation_Position=1200; Antisense; ATATTCGCAATCAGGTGTCGGTGGC
>probe:Drosophila_2:1627653_at:447:315; Interrogation_Position=1223; Antisense; GCGCGCAAAGCCAAACAGAGTCTGT
>probe:Drosophila_2:1627653_at:75:117; Interrogation_Position=1260; Antisense; AGCATTTTGTGTACTGGTGCCGCTA
>probe:Drosophila_2:1627653_at:99:507; Interrogation_Position=1276; Antisense; GTGCCGCTACGGAAGTCGTCAGCAG
>probe:Drosophila_2:1627653_at:98:199; Interrogation_Position=1321; Antisense; AACGACGAGTGCCAATCACGTGCTG
>probe:Drosophila_2:1627653_at:30:507; Interrogation_Position=1340; Antisense; GTGCTGCTGCACCTGATCAATTGAT
>probe:Drosophila_2:1627653_at:601:655; Interrogation_Position=1364; Antisense; TAAGTCGAGCCGAGTCAGCCGGAGT
>probe:Drosophila_2:1627653_at:319:313; Interrogation_Position=1509; Antisense; GCCACCCAAAAACTGTGCATTGATT
>probe:Drosophila_2:1627653_at:3:613; Interrogation_Position=1577; Antisense; TGAAAAACCACACATCATACCGACC
>probe:Drosophila_2:1627653_at:682:179; Interrogation_Position=1620; Antisense; AAAACTCTAGTACGCAACGTGGACT
>probe:Drosophila_2:1627653_at:655:685; Interrogation_Position=1721; Antisense; TATCTATGCACCCATCATTCAACTA
>probe:Drosophila_2:1627653_at:406:37; Interrogation_Position=1734; Antisense; ATCATTCAACTACCGATTCACGCTT
>probe:Drosophila_2:1627653_at:176:11; Interrogation_Position=1749; Antisense; ATTCACGCTTGCTTTGCTCATACAA

Paste this into a BLAST search page for me
GGTGCCGCACAACGAGAAGGATATTATATTCGCAATCAGGTGTCGGTGGCGCGCGCAAAGCCAAACAGAGTCTGTAGCATTTTGTGTACTGGTGCCGCTAGTGCCGCTACGGAAGTCGTCAGCAGAACGACGAGTGCCAATCACGTGCTGGTGCTGCTGCACCTGATCAATTGATTAAGTCGAGCCGAGTCAGCCGGAGTGCCACCCAAAAACTGTGCATTGATTTGAAAAACCACACATCATACCGACCAAAACTCTAGTACGCAACGTGGACTTATCTATGCACCCATCATTCAACTAATCATTCAACTACCGATTCACGCTTATTCACGCTTGCTTTGCTCATACAA

Full Affymetrix probeset data:

Annotations for 1627653_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime