FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627655_at:

>probe:Drosophila_2:1627655_at:612:79; Interrogation_Position=421; Antisense; AGGTCGATCGCCATATGGTGCTGAT
>probe:Drosophila_2:1627655_at:166:625; Interrogation_Position=492; Antisense; TGCGCCAAGCACTTCATCGTGGTGG
>probe:Drosophila_2:1627655_at:417:41; Interrogation_Position=507; Antisense; ATCGTGGTGGCCGACTACACAAAGA
>probe:Drosophila_2:1627655_at:673:207; Interrogation_Position=606; Antisense; AAGCTGCACATCGAGGCGCTTTTCG
>probe:Drosophila_2:1627655_at:73:317; Interrogation_Position=639; Antisense; GCCTCGTTGCGTATGGCCAAGGTGA
>probe:Drosophila_2:1627655_at:285:69; Interrogation_Position=664; Antisense; AGGCGGGACCCATTGTCACGGACAA
>probe:Drosophila_2:1627655_at:289:65; Interrogation_Position=688; Antisense; ATGGCAACTTCCTCCTGGACTGGAA
>probe:Drosophila_2:1627655_at:723:373; Interrogation_Position=710; Antisense; GAAGTTCATCGCCAACAGGGAGTAC
>probe:Drosophila_2:1627655_at:665:585; Interrogation_Position=781; Antisense; TGGAGACGGGCCTGTTCGTGAACAT
>probe:Drosophila_2:1627655_at:433:153; Interrogation_Position=802; Antisense; ACATGGCCCACAAATGCTACTACGG
>probe:Drosophila_2:1627655_at:450:69; Interrogation_Position=828; Antisense; ATGGCCAATGGCTCGGTCAAGGTCC
>probe:Drosophila_2:1627655_at:642:553; Interrogation_Position=882; Antisense; GGAGCGCTTTTTGCATTTATGTTTC
>probe:Drosophila_2:1627655_at:58:683; Interrogation_Position=899; Antisense; TATGTTTCACCAAGTTGTTCCTTAA
>probe:Drosophila_2:1627655_at:156:29; Interrogation_Position=955; Antisense; ATACATATTGAGTTCTTAGCCGAGA

Paste this into a BLAST search page for me
AGGTCGATCGCCATATGGTGCTGATTGCGCCAAGCACTTCATCGTGGTGGATCGTGGTGGCCGACTACACAAAGAAAGCTGCACATCGAGGCGCTTTTCGGCCTCGTTGCGTATGGCCAAGGTGAAGGCGGGACCCATTGTCACGGACAAATGGCAACTTCCTCCTGGACTGGAAGAAGTTCATCGCCAACAGGGAGTACTGGAGACGGGCCTGTTCGTGAACATACATGGCCCACAAATGCTACTACGGATGGCCAATGGCTCGGTCAAGGTCCGGAGCGCTTTTTGCATTTATGTTTCTATGTTTCACCAAGTTGTTCCTTAAATACATATTGAGTTCTTAGCCGAGA

Full Affymetrix probeset data:

Annotations for 1627655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720