Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627656_at:

>probe:Drosophila_2:1627656_at:118:263; Interrogation_Position=1183; Antisense; CAGCCGTTTTCATGCTCCGCAATGT
>probe:Drosophila_2:1627656_at:410:361; Interrogation_Position=1201; Antisense; GCAATGTGCCGGATTATCGCCGGAA
>probe:Drosophila_2:1627656_at:7:33; Interrogation_Position=1246; Antisense; ATAAGCAGCGCTTTTTTGTCAGATG
>probe:Drosophila_2:1627656_at:606:587; Interrogation_Position=1302; Antisense; TGGTTTCACCTATATAAGCCTCCTC
>probe:Drosophila_2:1627656_at:676:203; Interrogation_Position=1317; Antisense; AAGCCTCCTCTTTGTTGGATGGCAA
>probe:Drosophila_2:1627656_at:190:565; Interrogation_Position=1337; Antisense; GGCAAATTCTTGTTGACCATATTTC
>probe:Drosophila_2:1627656_at:596:413; Interrogation_Position=1351; Antisense; GACCATATTTCTTTACGTTGCGCAG
>probe:Drosophila_2:1627656_at:238:411; Interrogation_Position=1447; Antisense; GACGCACAAGTTAGTATTTGCTTTT
>probe:Drosophila_2:1627656_at:578:643; Interrogation_Position=1477; Antisense; TCATTTCTTAGTTTCGTTTGTTTCG
>probe:Drosophila_2:1627656_at:624:479; Interrogation_Position=1496; Antisense; GTTTCGCTTTTGAAGCTTTCGTTGG
>probe:Drosophila_2:1627656_at:446:271; Interrogation_Position=1511; Antisense; CTTTCGTTGGAGCTTTTGTAGTTTG
>probe:Drosophila_2:1627656_at:313:653; Interrogation_Position=1585; Antisense; TAATCTTAGCGCTTACTCCAGTTAC
>probe:Drosophila_2:1627656_at:421:603; Interrogation_Position=1619; Antisense; TGATTATTTTCGTAACACTCTGTTA
>probe:Drosophila_2:1627656_at:112:437; Interrogation_Position=1692; Antisense; GAGGATTGGGACTCGACTCGAAACA

Paste this into a BLAST search page for me
CAGCCGTTTTCATGCTCCGCAATGTGCAATGTGCCGGATTATCGCCGGAAATAAGCAGCGCTTTTTTGTCAGATGTGGTTTCACCTATATAAGCCTCCTCAAGCCTCCTCTTTGTTGGATGGCAAGGCAAATTCTTGTTGACCATATTTCGACCATATTTCTTTACGTTGCGCAGGACGCACAAGTTAGTATTTGCTTTTTCATTTCTTAGTTTCGTTTGTTTCGGTTTCGCTTTTGAAGCTTTCGTTGGCTTTCGTTGGAGCTTTTGTAGTTTGTAATCTTAGCGCTTACTCCAGTTACTGATTATTTTCGTAACACTCTGTTAGAGGATTGGGACTCGACTCGAAACA

Full Affymetrix probeset data:

Annotations for 1627656_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime