FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627657_at:

>probe:Drosophila_2:1627657_at:692:681; Interrogation_Position=371; Antisense; TATGCCAACGATATTTCACTGCTGC
>probe:Drosophila_2:1627657_at:730:21; Interrogation_Position=381; Antisense; ATATTTCACTGCTGCTCGTGGAGGA
>probe:Drosophila_2:1627657_at:665:289; Interrogation_Position=397; Antisense; CGTGGAGGAGCCATTCGAGTTTGAT
>probe:Drosophila_2:1627657_at:426:429; Interrogation_Position=413; Antisense; GAGTTTGATGGCGTCACGGTTGCAC
>probe:Drosophila_2:1627657_at:277:541; Interrogation_Position=430; Antisense; GGTTGCACCCGTAAAGTTGCCGGAG
>probe:Drosophila_2:1627657_at:710:633; Interrogation_Position=441; Antisense; TAAAGTTGCCGGAGCTCGCCTTTGC
>probe:Drosophila_2:1627657_at:96:721; Interrogation_Position=462; Antisense; TTGCCACACCTCAAACGGATGCCGG
>probe:Drosophila_2:1627657_at:469:403; Interrogation_Position=513; Antisense; GACTCAATGCGACTGGCGGATACAT
>probe:Drosophila_2:1627657_at:110:29; Interrogation_Position=532; Antisense; ATACATCCAATCCACACTGCAGGAG
>probe:Drosophila_2:1627657_at:511:447; Interrogation_Position=614; Antisense; GATCCCAGGTACCACATCTGCGGAG
>probe:Drosophila_2:1627657_at:107:47; Interrogation_Position=756; Antisense; ATCCGGGTGTTTACTGCAAGGTCAG
>probe:Drosophila_2:1627657_at:236:213; Interrogation_Position=803; Antisense; AAGAGCCAGATCATCTTGGCCTAGT
>probe:Drosophila_2:1627657_at:635:729; Interrogation_Position=818; Antisense; TTGGCCTAGTCATCGCATTATCTGA
>probe:Drosophila_2:1627657_at:348:679; Interrogation_Position=848; Antisense; TAGTGTATGGGCTATGCGTGCAATA

Paste this into a BLAST search page for me
TATGCCAACGATATTTCACTGCTGCATATTTCACTGCTGCTCGTGGAGGACGTGGAGGAGCCATTCGAGTTTGATGAGTTTGATGGCGTCACGGTTGCACGGTTGCACCCGTAAAGTTGCCGGAGTAAAGTTGCCGGAGCTCGCCTTTGCTTGCCACACCTCAAACGGATGCCGGGACTCAATGCGACTGGCGGATACATATACATCCAATCCACACTGCAGGAGGATCCCAGGTACCACATCTGCGGAGATCCGGGTGTTTACTGCAAGGTCAGAAGAGCCAGATCATCTTGGCCTAGTTTGGCCTAGTCATCGCATTATCTGATAGTGTATGGGCTATGCGTGCAATA

Full Affymetrix probeset data:

Annotations for 1627657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720