Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627660_a_at:

>probe:Drosophila_2:1627660_a_at:103:139; Interrogation_Position=385; Antisense; ACGAGGACTATGAGCTGACCGCCTT
>probe:Drosophila_2:1627660_a_at:342:393; Interrogation_Position=433; Antisense; GAAAGCTTGGCATTGAGTTCCTGCA
>probe:Drosophila_2:1627660_a_at:513:401; Interrogation_Position=471; Antisense; GACATCTTTGAGTCGCCCAATCAAG
>probe:Drosophila_2:1627660_a_at:568:209; Interrogation_Position=493; Antisense; AAGAAAAGCTCTTCCGCGGCGTGGA
>probe:Drosophila_2:1627660_a_at:85:31; Interrogation_Position=522; Antisense; ATAAACAAGTTCCTGCCTCTAAAGC
>probe:Drosophila_2:1627660_a_at:421:361; Interrogation_Position=550; Antisense; GAATTGGTGGCCTAAGTTCCTCCTA
>probe:Drosophila_2:1627660_a_at:512:593; Interrogation_Position=589; Antisense; TGGGTTCTGTCTATGTGCACTGCAA
>probe:Drosophila_2:1627660_a_at:197:287; Interrogation_Position=616; Antisense; CTGGTAGGACGCGAAGTGCCACTTT
>probe:Drosophila_2:1627660_a_at:175:149; Interrogation_Position=636; Antisense; ACTTTGGTGGGATGCTACCTCATGA
>probe:Drosophila_2:1627660_a_at:153:35; Interrogation_Position=682; Antisense; ATCAGGCGGTTGACCACATGCGTAA
>probe:Drosophila_2:1627660_a_at:259:11; Interrogation_Position=720; Antisense; ATTCTGCTGCACACCAAACAATGGG
>probe:Drosophila_2:1627660_a_at:386:179; Interrogation_Position=735; Antisense; AAACAATGGGATGCCCTCCGGTTAT
>probe:Drosophila_2:1627660_a_at:705:255; Interrogation_Position=846; Antisense; CAAAGGTGGTGCCTGTTACCCAACT
>probe:Drosophila_2:1627660_a_at:665:473; Interrogation_Position=860; Antisense; GTTACCCAACTACTTTAGTGCTGAT

Paste this into a BLAST search page for me
ACGAGGACTATGAGCTGACCGCCTTGAAAGCTTGGCATTGAGTTCCTGCAGACATCTTTGAGTCGCCCAATCAAGAAGAAAAGCTCTTCCGCGGCGTGGAATAAACAAGTTCCTGCCTCTAAAGCGAATTGGTGGCCTAAGTTCCTCCTATGGGTTCTGTCTATGTGCACTGCAACTGGTAGGACGCGAAGTGCCACTTTACTTTGGTGGGATGCTACCTCATGAATCAGGCGGTTGACCACATGCGTAAATTCTGCTGCACACCAAACAATGGGAAACAATGGGATGCCCTCCGGTTATCAAAGGTGGTGCCTGTTACCCAACTGTTACCCAACTACTTTAGTGCTGAT

Full Affymetrix probeset data:

Annotations for 1627660_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime