Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627661_at:

>probe:Drosophila_2:1627661_at:315:219; Interrogation_Position=1063; Antisense; AAGTGATATCGCTTGATGCCACCCG
>probe:Drosophila_2:1627661_at:325:687; Interrogation_Position=1088; Antisense; TATACGTATGTAGCCTGCCCAGCGG
>probe:Drosophila_2:1627661_at:94:395; Interrogation_Position=1118; Antisense; GAAATAAAACCGCATTCACCCATCG
>probe:Drosophila_2:1627661_at:365:97; Interrogation_Position=563; Antisense; AGATCAAGCTGAATCGCCTGCACAA
>probe:Drosophila_2:1627661_at:265:133; Interrogation_Position=631; Antisense; ACGCCGGAGTCCTTGATGCGCAAAC
>probe:Drosophila_2:1627661_at:516:359; Interrogation_Position=656; Antisense; GCAAGGAGTACATGCCACCGCGTTT
>probe:Drosophila_2:1627661_at:494:71; Interrogation_Position=695; Antisense; AGGCGGCTCATCAGTTGCTGTCCAT
>probe:Drosophila_2:1627661_at:478:137; Interrogation_Position=761; Antisense; ACGAGCAGTCACTGTGCGTTGGACT
>probe:Drosophila_2:1627661_at:701:431; Interrogation_Position=802; Antisense; GAGTCGCAGCAGATTGCCGTTGGCA
>probe:Drosophila_2:1627661_at:621:607; Interrogation_Position=834; Antisense; TGAGATGCGCTCGACCGATTTGGGC
>probe:Drosophila_2:1627661_at:525:37; Interrogation_Position=877; Antisense; ATCATTCCCGCCAAGGAGATGCATC
>probe:Drosophila_2:1627661_at:514:587; Interrogation_Position=911; Antisense; TGGAGTTCTTGCAGCAGTATGCCCC
>probe:Drosophila_2:1627661_at:671:665; Interrogation_Position=955; Antisense; TACAACCACTAATTCCGCTGCGAAA
>probe:Drosophila_2:1627661_at:604:559; Interrogation_Position=999; Antisense; GGAAATGTTGTCTGTGCATCTGAAT

Paste this into a BLAST search page for me
AAGTGATATCGCTTGATGCCACCCGTATACGTATGTAGCCTGCCCAGCGGGAAATAAAACCGCATTCACCCATCGAGATCAAGCTGAATCGCCTGCACAAACGCCGGAGTCCTTGATGCGCAAACGCAAGGAGTACATGCCACCGCGTTTAGGCGGCTCATCAGTTGCTGTCCATACGAGCAGTCACTGTGCGTTGGACTGAGTCGCAGCAGATTGCCGTTGGCATGAGATGCGCTCGACCGATTTGGGCATCATTCCCGCCAAGGAGATGCATCTGGAGTTCTTGCAGCAGTATGCCCCTACAACCACTAATTCCGCTGCGAAAGGAAATGTTGTCTGTGCATCTGAAT

Full Affymetrix probeset data:

Annotations for 1627661_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime