Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627662_at:

>probe:Drosophila_2:1627662_at:271:465; Interrogation_Position=1221; Antisense; GATTGCCCATTTTCTATGATCAGCA
>probe:Drosophila_2:1627662_at:652:483; Interrogation_Position=1271; Antisense; GTAGGCTATGGTCTCAGTGCTGATA
>probe:Drosophila_2:1627662_at:556:383; Interrogation_Position=1316; Antisense; GAACTGACGCCTTTGATCCAGGAAT
>probe:Drosophila_2:1627662_at:161:89; Interrogation_Position=1346; Antisense; AGTAATCCCAGTTATGCGGCAGCAG
>probe:Drosophila_2:1627662_at:681:331; Interrogation_Position=1361; Antisense; GCGGCAGCAGCTCAGACTAAATCCA
>probe:Drosophila_2:1627662_at:292:225; Interrogation_Position=1403; Antisense; AAGGAAACCGCTTTGGAGCGCGCCA
>probe:Drosophila_2:1627662_at:542:123; Interrogation_Position=1419; Antisense; AGCGCGCCATTTGGTGGACCGAGTA
>probe:Drosophila_2:1627662_at:701:507; Interrogation_Position=1479; Antisense; GTGCTTCGCGTGATCTGGATTTTAT
>probe:Drosophila_2:1627662_at:326:461; Interrogation_Position=1496; Antisense; GATTTTATTCAGTTCCACGGACTGG
>probe:Drosophila_2:1627662_at:560:497; Interrogation_Position=1553; Antisense; GTCTCCCTACTGATCGTCGTTATTT
>probe:Drosophila_2:1627662_at:698:663; Interrogation_Position=1590; Antisense; TACAAAGGGTCTTCGTTTCGCTTAT
>probe:Drosophila_2:1627662_at:428:661; Interrogation_Position=1682; Antisense; TAACTGTTTGAGTTCATGCCGCCAC
>probe:Drosophila_2:1627662_at:15:131; Interrogation_Position=1705; Antisense; ACCGACTTATGTTTCCTCTTAGAGC
>probe:Drosophila_2:1627662_at:677:699; Interrogation_Position=1744; Antisense; TTTTTGTTTTGTTACCAGCACCTGT

Paste this into a BLAST search page for me
GATTGCCCATTTTCTATGATCAGCAGTAGGCTATGGTCTCAGTGCTGATAGAACTGACGCCTTTGATCCAGGAATAGTAATCCCAGTTATGCGGCAGCAGGCGGCAGCAGCTCAGACTAAATCCAAAGGAAACCGCTTTGGAGCGCGCCAAGCGCGCCATTTGGTGGACCGAGTAGTGCTTCGCGTGATCTGGATTTTATGATTTTATTCAGTTCCACGGACTGGGTCTCCCTACTGATCGTCGTTATTTTACAAAGGGTCTTCGTTTCGCTTATTAACTGTTTGAGTTCATGCCGCCACACCGACTTATGTTTCCTCTTAGAGCTTTTTGTTTTGTTACCAGCACCTGT

Full Affymetrix probeset data:

Annotations for 1627662_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime