Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627665_at:

>probe:Drosophila_2:1627665_at:227:445; Interrogation_Position=1253; Antisense; GATGAGAGTCTTGGATGTGCCTTCT
>probe:Drosophila_2:1627665_at:149:63; Interrogation_Position=1267; Antisense; ATGTGCCTTCTGGTTTGCTTCGCAT
>probe:Drosophila_2:1627665_at:314:345; Interrogation_Position=1288; Antisense; GCATTGCACTCACTCTACTGCTAGA
>probe:Drosophila_2:1627665_at:643:669; Interrogation_Position=1303; Antisense; TACTGCTAGAGTCGCTCTTATCGGA
>probe:Drosophila_2:1627665_at:483:481; Interrogation_Position=1354; Antisense; GTATACCCGCTATCGCAACAGTTAT
>probe:Drosophila_2:1627665_at:203:267; Interrogation_Position=1372; Antisense; CAGTTATAGCCGTTGTCTGGGAAAC
>probe:Drosophila_2:1627665_at:301:41; Interrogation_Position=1398; Antisense; ATCTGGAGCGCCAACTTGCTGTGCA
>probe:Drosophila_2:1627665_at:281:585; Interrogation_Position=1442; Antisense; TGGCAACGTATTTCGGCCCGTAATT
>probe:Drosophila_2:1627665_at:402:651; Interrogation_Position=1462; Antisense; TAATTTAGCCAGAGATGACCGCATT
>probe:Drosophila_2:1627665_at:709:109; Interrogation_Position=1507; Antisense; AGCAAGATCCCCATTCATCGAAGAG
>probe:Drosophila_2:1627665_at:670:587; Interrogation_Position=1574; Antisense; TGTTGCTTTGGTTTCCCGGAAGGAG
>probe:Drosophila_2:1627665_at:651:405; Interrogation_Position=1620; Antisense; GACTGTATGGCTATCAAATCGGTTT
>probe:Drosophila_2:1627665_at:198:519; Interrogation_Position=1671; Antisense; GGGCTATTCAATTTGGGTCCCGAAT
>probe:Drosophila_2:1627665_at:269:185; Interrogation_Position=1710; Antisense; AAAATGGCTCTCATCAATCTGATAA

Paste this into a BLAST search page for me
GATGAGAGTCTTGGATGTGCCTTCTATGTGCCTTCTGGTTTGCTTCGCATGCATTGCACTCACTCTACTGCTAGATACTGCTAGAGTCGCTCTTATCGGAGTATACCCGCTATCGCAACAGTTATCAGTTATAGCCGTTGTCTGGGAAACATCTGGAGCGCCAACTTGCTGTGCATGGCAACGTATTTCGGCCCGTAATTTAATTTAGCCAGAGATGACCGCATTAGCAAGATCCCCATTCATCGAAGAGTGTTGCTTTGGTTTCCCGGAAGGAGGACTGTATGGCTATCAAATCGGTTTGGGCTATTCAATTTGGGTCCCGAATAAAATGGCTCTCATCAATCTGATAA

Full Affymetrix probeset data:

Annotations for 1627665_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime