FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627666_at:

>probe:Drosophila_2:1627666_at:128:335; Interrogation_Position=2714; Antisense; GCTGTCATCAGCAACCTGTGGAACA
>probe:Drosophila_2:1627666_at:443:161; Interrogation_Position=2736; Antisense; ACAAGGTCAACACTGCGATTGCCCA
>probe:Drosophila_2:1627666_at:19:3; Interrogation_Position=2882; Antisense; ATATGCGAAGCCACCGTTCCCGAAA
>probe:Drosophila_2:1627666_at:132:391; Interrogation_Position=2903; Antisense; GAAACGCTGGCGACCACTGGTATGG
>probe:Drosophila_2:1627666_at:403:143; Interrogation_Position=2918; Antisense; ACTGGTATGGATTGCCTGCGAGGAA
>probe:Drosophila_2:1627666_at:415:253; Interrogation_Position=2951; Antisense; CAAGCGGGAGCTTCGACAGTGTTTC
>probe:Drosophila_2:1627666_at:484:71; Interrogation_Position=3006; Antisense; AGGCGGCTGCCAATGGGACCATACA
>probe:Drosophila_2:1627666_at:178:529; Interrogation_Position=3020; Antisense; GGGACCATACAGTTCACTCTGGACA
>probe:Drosophila_2:1627666_at:464:711; Interrogation_Position=3032; Antisense; TTCACTCTGGACAGTCTTCTACGAG
>probe:Drosophila_2:1627666_at:510:35; Interrogation_Position=3104; Antisense; ATCATCGTTTCTACTTTCACAGCTT
>probe:Drosophila_2:1627666_at:220:639; Interrogation_Position=3129; Antisense; TCGGTTGTCTTTCCTACTGGATTTT
>probe:Drosophila_2:1627666_at:234:709; Interrogation_Position=3153; Antisense; TTACTCAAACTTTCAGCTGGTCGCA
>probe:Drosophila_2:1627666_at:500:635; Interrogation_Position=3173; Antisense; TCGCATTCGCATCAACCGTTTTGAA
>probe:Drosophila_2:1627666_at:399:27; Interrogation_Position=3262; Antisense; ATACGCTTCGAGTATTACGCGGTAA

Paste this into a BLAST search page for me
GCTGTCATCAGCAACCTGTGGAACAACAAGGTCAACACTGCGATTGCCCAATATGCGAAGCCACCGTTCCCGAAAGAAACGCTGGCGACCACTGGTATGGACTGGTATGGATTGCCTGCGAGGAACAAGCGGGAGCTTCGACAGTGTTTCAGGCGGCTGCCAATGGGACCATACAGGGACCATACAGTTCACTCTGGACATTCACTCTGGACAGTCTTCTACGAGATCATCGTTTCTACTTTCACAGCTTTCGGTTGTCTTTCCTACTGGATTTTTTACTCAAACTTTCAGCTGGTCGCATCGCATTCGCATCAACCGTTTTGAAATACGCTTCGAGTATTACGCGGTAA

Full Affymetrix probeset data:

Annotations for 1627666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720