FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627669_at:

>probe:Drosophila_2:1627669_at:32:467; Interrogation_Position=1019; Antisense; GATTGGCTATTTCAAGGGCATCCTG
>probe:Drosophila_2:1627669_at:9:83; Interrogation_Position=1033; Antisense; AGGGCATCCTGTGGAAATCCTTCCT
>probe:Drosophila_2:1627669_at:405:583; Interrogation_Position=1070; Antisense; TGGCTCGCTTAGCTATGTCCGCATG
>probe:Drosophila_2:1627669_at:597:47; Interrogation_Position=1098; Antisense; ATCCGGCCGCTCAAGAAACAGTAGA
>probe:Drosophila_2:1627669_at:472:689; Interrogation_Position=654; Antisense; TTTGGCGCTTTAAACTCGGAGTTCT
>probe:Drosophila_2:1627669_at:547:659; Interrogation_Position=692; Antisense; TAAGCTGCACAGGTTGACCAACAGT
>probe:Drosophila_2:1627669_at:593:353; Interrogation_Position=719; Antisense; GCACCACGAGTTGCTCATCATAATG
>probe:Drosophila_2:1627669_at:124:589; Interrogation_Position=755; Antisense; TGGAGAGGAACGTTTCGCGCTGTAC
>probe:Drosophila_2:1627669_at:111:323; Interrogation_Position=771; Antisense; GCGCTGTACGATCACTTCAGTATTG
>probe:Drosophila_2:1627669_at:683:685; Interrogation_Position=813; Antisense; TATCTTCTATATGTACTTGGTGCCT
>probe:Drosophila_2:1627669_at:522:605; Interrogation_Position=845; Antisense; TGATGCTGGTGATTCGCTACGTTAC
>probe:Drosophila_2:1627669_at:92:375; Interrogation_Position=881; Antisense; GAAGTTCACCACATTCGATCAGGAT
>probe:Drosophila_2:1627669_at:48:179; Interrogation_Position=923; Antisense; AAACTGCGCCAGGACGCATGCAGGT
>probe:Drosophila_2:1627669_at:526:191; Interrogation_Position=981; Antisense; AACTTGTTTGGTACATTCCAGTCGA

Paste this into a BLAST search page for me
GATTGGCTATTTCAAGGGCATCCTGAGGGCATCCTGTGGAAATCCTTCCTTGGCTCGCTTAGCTATGTCCGCATGATCCGGCCGCTCAAGAAACAGTAGATTTGGCGCTTTAAACTCGGAGTTCTTAAGCTGCACAGGTTGACCAACAGTGCACCACGAGTTGCTCATCATAATGTGGAGAGGAACGTTTCGCGCTGTACGCGCTGTACGATCACTTCAGTATTGTATCTTCTATATGTACTTGGTGCCTTGATGCTGGTGATTCGCTACGTTACGAAGTTCACCACATTCGATCAGGATAAACTGCGCCAGGACGCATGCAGGTAACTTGTTTGGTACATTCCAGTCGA

Full Affymetrix probeset data:

Annotations for 1627669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720