Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627670_at:

>probe:Drosophila_2:1627670_at:545:673; Interrogation_Position=1192; Antisense; TAGCACCGTCCGTTGGAAACTGGAT
>probe:Drosophila_2:1627670_at:693:673; Interrogation_Position=1216; Antisense; TAGCTTCACTGACAACAGGGCGGCT
>probe:Drosophila_2:1627670_at:489:573; Interrogation_Position=1237; Antisense; GGCTGAGCGACGTGCTAATCGAGCA
>probe:Drosophila_2:1627670_at:137:237; Interrogation_Position=1253; Antisense; AATCGAGCAGCAGATTCTCACGCGC
>probe:Drosophila_2:1627670_at:222:645; Interrogation_Position=1294; Antisense; TCATGTCCTGGTTGGTCTTCCTATG
>probe:Drosophila_2:1627670_at:72:275; Interrogation_Position=1310; Antisense; CTTCCTATGCGGATCCATGTACATG
>probe:Drosophila_2:1627670_at:427:259; Interrogation_Position=1357; Antisense; CACGAATCTGGAGCGTTCTTGGCAT
>probe:Drosophila_2:1627670_at:190:65; Interrogation_Position=1380; Antisense; ATGGGAGCCTACTATGCGAGCATTA
>probe:Drosophila_2:1627670_at:343:345; Interrogation_Position=1399; Antisense; GCATTAAGCTGCTACCGCTGGATAT
>probe:Drosophila_2:1627670_at:675:57; Interrogation_Position=1422; Antisense; ATGAGTCCCAACTATGCTGGCACTT
>probe:Drosophila_2:1627670_at:189:147; Interrogation_Position=1443; Antisense; ACTTTGATGGGCATTTCGGGCGGCA
>probe:Drosophila_2:1627670_at:690:147; Interrogation_Position=1484; Antisense; ACTTCTGATGCCCTATCTGGAACAA
>probe:Drosophila_2:1627670_at:411:269; Interrogation_Position=1550; Antisense; CATGTGGGTAATCGGCGCCAGCTAC
>probe:Drosophila_2:1627670_at:403:683; Interrogation_Position=1576; Antisense; TATCCGGCGATGTCCAGGCGTTTAA

Paste this into a BLAST search page for me
TAGCACCGTCCGTTGGAAACTGGATTAGCTTCACTGACAACAGGGCGGCTGGCTGAGCGACGTGCTAATCGAGCAAATCGAGCAGCAGATTCTCACGCGCTCATGTCCTGGTTGGTCTTCCTATGCTTCCTATGCGGATCCATGTACATGCACGAATCTGGAGCGTTCTTGGCATATGGGAGCCTACTATGCGAGCATTAGCATTAAGCTGCTACCGCTGGATATATGAGTCCCAACTATGCTGGCACTTACTTTGATGGGCATTTCGGGCGGCAACTTCTGATGCCCTATCTGGAACAACATGTGGGTAATCGGCGCCAGCTACTATCCGGCGATGTCCAGGCGTTTAA

Full Affymetrix probeset data:

Annotations for 1627670_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime