FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627672_at:

>probe:Drosophila_2:1627672_at:66:613; Interrogation_Position=289; Antisense; TGAAAACAACAACCACGCTTCGTCT
>probe:Drosophila_2:1627672_at:95:135; Interrogation_Position=303; Antisense; ACGCTTCGTCTAGTCGGCAGTAGTA
>probe:Drosophila_2:1627672_at:478:39; Interrogation_Position=327; Antisense; ATCTGTGTACGTTTCGGTGTATCTG
>probe:Drosophila_2:1627672_at:131:41; Interrogation_Position=347; Antisense; ATCTGTATCTGTGTCCGCTCAATCT
>probe:Drosophila_2:1627672_at:515:297; Interrogation_Position=362; Antisense; CGCTCAATCTTTGCTCAATCGCAAT
>probe:Drosophila_2:1627672_at:299:695; Interrogation_Position=431; Antisense; TTTACGTTTCTGTTGACTTTTGCCA
>probe:Drosophila_2:1627672_at:495:719; Interrogation_Position=450; Antisense; TTGCCAGCCGCAAAGCCAAAAGTTA
>probe:Drosophila_2:1627672_at:399:103; Interrogation_Position=543; Antisense; AGACTGTTGCCACAGTTCCTGCAAT
>probe:Drosophila_2:1627672_at:303:615; Interrogation_Position=562; Antisense; TGCAATTCGTGGTTTCTCGCCGGAA
>probe:Drosophila_2:1627672_at:571:173; Interrogation_Position=589; Antisense; AAAGCAGCTGCGGTCCATTTAAGAA
>probe:Drosophila_2:1627672_at:326:225; Interrogation_Position=618; Antisense; AAGGAGCACAGAACTGCCGCGAAAT
>probe:Drosophila_2:1627672_at:471:85; Interrogation_Position=704; Antisense; AGTGATCTGGACTTGGCGGCACGTC
>probe:Drosophila_2:1627672_at:146:407; Interrogation_Position=842; Antisense; GACGGCCTGAACATGACAGTGCCCA
>probe:Drosophila_2:1627672_at:221:399; Interrogation_Position=856; Antisense; GACAGTGCCCAAGGGTTCCATGTGA

Paste this into a BLAST search page for me
TGAAAACAACAACCACGCTTCGTCTACGCTTCGTCTAGTCGGCAGTAGTAATCTGTGTACGTTTCGGTGTATCTGATCTGTATCTGTGTCCGCTCAATCTCGCTCAATCTTTGCTCAATCGCAATTTTACGTTTCTGTTGACTTTTGCCATTGCCAGCCGCAAAGCCAAAAGTTAAGACTGTTGCCACAGTTCCTGCAATTGCAATTCGTGGTTTCTCGCCGGAAAAAGCAGCTGCGGTCCATTTAAGAAAAGGAGCACAGAACTGCCGCGAAATAGTGATCTGGACTTGGCGGCACGTCGACGGCCTGAACATGACAGTGCCCAGACAGTGCCCAAGGGTTCCATGTGA

Full Affymetrix probeset data:

Annotations for 1627672_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720