Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627673_at:

>probe:Drosophila_2:1627673_at:223:569; Interrogation_Position=2700; Antisense; GGCAGTAGCAATTATTATCCCAGCA
>probe:Drosophila_2:1627673_at:477:703; Interrogation_Position=2714; Antisense; TTATCCCAGCACTGCGGGCAATGTG
>probe:Drosophila_2:1627673_at:697:329; Interrogation_Position=2727; Antisense; GCGGGCAATGTGCATCAACGATCAC
>probe:Drosophila_2:1627673_at:232:455; Interrogation_Position=2746; Antisense; GATCACAGTTCTTCGATAGATTAGT
>probe:Drosophila_2:1627673_at:269:695; Interrogation_Position=2770; Antisense; TTTAGCTCTCTTTAAGTTCCGTCCG
>probe:Drosophila_2:1627673_at:391:95; Interrogation_Position=2796; Antisense; AGATCCGCTGGTCTACATTGAGGCC
>probe:Drosophila_2:1627673_at:371:497; Interrogation_Position=2828; Antisense; GTCTGCGAACGGTAGTCCCTTTAGA
>probe:Drosophila_2:1627673_at:492:93; Interrogation_Position=2867; Antisense; AGATTCCTAAGCCAAACACCTTCAA
>probe:Drosophila_2:1627673_at:102:159; Interrogation_Position=2892; Antisense; ACACACACAACACGACAACACTATT
>probe:Drosophila_2:1627673_at:613:131; Interrogation_Position=2975; Antisense; ACGACGATACCGAAACCAAGGCGAT
>probe:Drosophila_2:1627673_at:441:501; Interrogation_Position=3001; Antisense; GTCGAAAAGCATGGATCGCGCCAAT
>probe:Drosophila_2:1627673_at:681:247; Interrogation_Position=3022; Antisense; CAATAATTCTATATTCCCCGCTTTC
>probe:Drosophila_2:1627673_at:606:281; Interrogation_Position=3054; Antisense; CTCGACTCGCCTTACATTTTGTATA
>probe:Drosophila_2:1627673_at:536:155; Interrogation_Position=3191; Antisense; ACACGCTTAGCCGTAAATTCAATTG

Paste this into a BLAST search page for me
GGCAGTAGCAATTATTATCCCAGCATTATCCCAGCACTGCGGGCAATGTGGCGGGCAATGTGCATCAACGATCACGATCACAGTTCTTCGATAGATTAGTTTTAGCTCTCTTTAAGTTCCGTCCGAGATCCGCTGGTCTACATTGAGGCCGTCTGCGAACGGTAGTCCCTTTAGAAGATTCCTAAGCCAAACACCTTCAAACACACACAACACGACAACACTATTACGACGATACCGAAACCAAGGCGATGTCGAAAAGCATGGATCGCGCCAATCAATAATTCTATATTCCCCGCTTTCCTCGACTCGCCTTACATTTTGTATAACACGCTTAGCCGTAAATTCAATTG

Full Affymetrix probeset data:

Annotations for 1627673_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime