FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627674_at:

>probe:Drosophila_2:1627674_at:187:69; Interrogation_Position=13; Antisense; ATGGCCAAATGCGAATGTCTTCTCG
>probe:Drosophila_2:1627674_at:214:41; Interrogation_Position=182; Antisense; ATCTGTATTGGACCAGGATCACCCA
>probe:Drosophila_2:1627674_at:175:267; Interrogation_Position=195; Antisense; CAGGATCACCCAAACGGACTTTACA
>probe:Drosophila_2:1627674_at:582:625; Interrogation_Position=225; Antisense; TGCCGTTGAGCTGCATTGTTCCTTA
>probe:Drosophila_2:1627674_at:572:727; Interrogation_Position=240; Antisense; TTGTTCCTTACCCTGGATGCGTCAT
>probe:Drosophila_2:1627674_at:245:271; Interrogation_Position=262; Antisense; CATCAGATGGCTATTTATACGCGAA
>probe:Drosophila_2:1627674_at:281:687; Interrogation_Position=277; Antisense; TATACGCGAAAAGCCATCCCGAGTG
>probe:Drosophila_2:1627674_at:35:405; Interrogation_Position=306; Antisense; GACTCTCGAAGATATAGCTGCGTAT
>probe:Drosophila_2:1627674_at:555:225; Interrogation_Position=382; Antisense; AAGGACTGTCGGTCGCAGAAGCCTC
>probe:Drosophila_2:1627674_at:64:109; Interrogation_Position=398; Antisense; AGAAGCCTCCGATCATGCAGCGCTG
>probe:Drosophila_2:1627674_at:553:521; Interrogation_Position=42; Antisense; GGGCCTGGTTCCATTGATGCTGACC
>probe:Drosophila_2:1627674_at:267:569; Interrogation_Position=422; Antisense; GGCATTTGTCCCGATATCTGTACAT
>probe:Drosophila_2:1627674_at:265:235; Interrogation_Position=454; Antisense; AATCCGGTTTATGTCAAGCCCTTGG
>probe:Drosophila_2:1627674_at:215:271; Interrogation_Position=72; Antisense; CATCGTGGCCACTTGGACTTGGAGA

Paste this into a BLAST search page for me
ATGGCCAAATGCGAATGTCTTCTCGATCTGTATTGGACCAGGATCACCCACAGGATCACCCAAACGGACTTTACATGCCGTTGAGCTGCATTGTTCCTTATTGTTCCTTACCCTGGATGCGTCATCATCAGATGGCTATTTATACGCGAATATACGCGAAAAGCCATCCCGAGTGGACTCTCGAAGATATAGCTGCGTATAAGGACTGTCGGTCGCAGAAGCCTCAGAAGCCTCCGATCATGCAGCGCTGGGGCCTGGTTCCATTGATGCTGACCGGCATTTGTCCCGATATCTGTACATAATCCGGTTTATGTCAAGCCCTTGGCATCGTGGCCACTTGGACTTGGAGA

Full Affymetrix probeset data:

Annotations for 1627674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720