Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627676_at:

>probe:Drosophila_2:1627676_at:668:355; Interrogation_Position=1087; Antisense; GCACTATTCCTTGCAGAGTCTCTAT
>probe:Drosophila_2:1627676_at:475:429; Interrogation_Position=1124; Antisense; GAGTTCTCTGCGAGGCACCTAAAAC
>probe:Drosophila_2:1627676_at:215:437; Interrogation_Position=1152; Antisense; GAGGACGTCTTGTCTGCTGGATACC
>probe:Drosophila_2:1627676_at:172:545; Interrogation_Position=1170; Antisense; GGATACCCTTTCACAGCGAGGACTA
>probe:Drosophila_2:1627676_at:137:325; Interrogation_Position=1185; Antisense; GCGAGGACTACGACCCGAAGATGCT
>probe:Drosophila_2:1627676_at:495:415; Interrogation_Position=1228; Antisense; GAGCCTGATAGCTAACTCTGAGCAG
>probe:Drosophila_2:1627676_at:481:69; Interrogation_Position=1274; Antisense; AGGCGGCTACTCACCTATGAAAAGT
>probe:Drosophila_2:1627676_at:232:189; Interrogation_Position=1315; Antisense; AACAGAACCCTTATTGTGCAGCATA
>probe:Drosophila_2:1627676_at:456:297; Interrogation_Position=1359; Antisense; CGCAGGACTTCAGGGATCGGTACTT
>probe:Drosophila_2:1627676_at:259:389; Interrogation_Position=1470; Antisense; GAAAGATTCCTACGGATGGGCGCTC
>probe:Drosophila_2:1627676_at:97:595; Interrogation_Position=1486; Antisense; TGGGCGCTCCAAAAAGTGTGACCTG
>probe:Drosophila_2:1627676_at:568:117; Interrogation_Position=1516; Antisense; AGCTCGATTTATGTGATCTCCATTG
>probe:Drosophila_2:1627676_at:697:457; Interrogation_Position=1559; Antisense; GATATAACTTCGATTCGGGCCAAAT
>probe:Drosophila_2:1627676_at:48:299; Interrogation_Position=1602; Antisense; CGCTGAGTTTTCTTGTATGGCATAC

Paste this into a BLAST search page for me
GCACTATTCCTTGCAGAGTCTCTATGAGTTCTCTGCGAGGCACCTAAAACGAGGACGTCTTGTCTGCTGGATACCGGATACCCTTTCACAGCGAGGACTAGCGAGGACTACGACCCGAAGATGCTGAGCCTGATAGCTAACTCTGAGCAGAGGCGGCTACTCACCTATGAAAAGTAACAGAACCCTTATTGTGCAGCATACGCAGGACTTCAGGGATCGGTACTTGAAAGATTCCTACGGATGGGCGCTCTGGGCGCTCCAAAAAGTGTGACCTGAGCTCGATTTATGTGATCTCCATTGGATATAACTTCGATTCGGGCCAAATCGCTGAGTTTTCTTGTATGGCATAC

Full Affymetrix probeset data:

Annotations for 1627676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime