FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627678_at:

>probe:Drosophila_2:1627678_at:184:179; Interrogation_Position=1000; Antisense; AAACTCACTAATGTCGACTGCAAAG
>probe:Drosophila_2:1627678_at:517:391; Interrogation_Position=1043; Antisense; GAAACGATCGTCTAACATCCGACAA
>probe:Drosophila_2:1627678_at:83:463; Interrogation_Position=1079; Antisense; GATTACGTGATATCCTGCCAAATGT
>probe:Drosophila_2:1627678_at:459:483; Interrogation_Position=1102; Antisense; GTAGTGCTCGATTACATGTTTCCCG
>probe:Drosophila_2:1627678_at:20:153; Interrogation_Position=1115; Antisense; ACATGTTTCCCGATCCTTTGTACAA
>probe:Drosophila_2:1627678_at:326:389; Interrogation_Position=1170; Antisense; GAAAACCGTTCTCAACGATCGCATG
>probe:Drosophila_2:1627678_at:51:463; Interrogation_Position=637; Antisense; GATTCACCGATTATACTCACTTTTG
>probe:Drosophila_2:1627678_at:413:423; Interrogation_Position=672; Antisense; GAGACCATTAGTGTTTATTGCCAGA
>probe:Drosophila_2:1627678_at:402:365; Interrogation_Position=704; Antisense; GAATATACGAATTTCCGCCGGAGAA
>probe:Drosophila_2:1627678_at:41:33; Interrogation_Position=752; Antisense; ATAAGATCTGCAGCTTCGTCTTCCA
>probe:Drosophila_2:1627678_at:509:671; Interrogation_Position=780; Antisense; TACCTGCACCTATTTCCTGATGGAA
>probe:Drosophila_2:1627678_at:567:35; Interrogation_Position=876; Antisense; ATCATCGGTTAAGTCTCTGGAGCAC
>probe:Drosophila_2:1627678_at:450:681; Interrogation_Position=901; Antisense; TATGGCCAGCAGATCCACAGCGGTG
>probe:Drosophila_2:1627678_at:705:257; Interrogation_Position=916; Antisense; CACAGCGGTGGGTTTTTCAAGTACA

Paste this into a BLAST search page for me
AAACTCACTAATGTCGACTGCAAAGGAAACGATCGTCTAACATCCGACAAGATTACGTGATATCCTGCCAAATGTGTAGTGCTCGATTACATGTTTCCCGACATGTTTCCCGATCCTTTGTACAAGAAAACCGTTCTCAACGATCGCATGGATTCACCGATTATACTCACTTTTGGAGACCATTAGTGTTTATTGCCAGAGAATATACGAATTTCCGCCGGAGAAATAAGATCTGCAGCTTCGTCTTCCATACCTGCACCTATTTCCTGATGGAAATCATCGGTTAAGTCTCTGGAGCACTATGGCCAGCAGATCCACAGCGGTGCACAGCGGTGGGTTTTTCAAGTACA

Full Affymetrix probeset data:

Annotations for 1627678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720