FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627680_at:

>probe:Drosophila_2:1627680_at:62:201; Interrogation_Position=3195; Antisense; AACCCTACTCTATCAGTGTGTCTTG
>probe:Drosophila_2:1627680_at:718:513; Interrogation_Position=3212; Antisense; GTGTCTTGTTGAAGGAGGTCCCCAT
>probe:Drosophila_2:1627680_at:74:13; Interrogation_Position=3235; Antisense; ATTCAGGCGTTGTTTTCAGCCCTTG
>probe:Drosophila_2:1627680_at:619:407; Interrogation_Position=3306; Antisense; GACGGAGCTGAATGCGTACGCCTTT
>probe:Drosophila_2:1627680_at:20:431; Interrogation_Position=3337; Antisense; GAGTATTGTGCCGACATATCCTATT
>probe:Drosophila_2:1627680_at:113:711; Interrogation_Position=3361; Antisense; TTAACGGCTCACTACATCCTGATAA
>probe:Drosophila_2:1627680_at:627:121; Interrogation_Position=3402; Antisense; AGCGTTGTGCTATCTACAGACTCGC
>probe:Drosophila_2:1627680_at:627:403; Interrogation_Position=3420; Antisense; GACTCGCATACGAATGTTTCCCAAT
>probe:Drosophila_2:1627680_at:448:7; Interrogation_Position=3443; Antisense; ATTCCCGAAGTCTGCGAAGTGTCGT
>probe:Drosophila_2:1627680_at:292:235; Interrogation_Position=3503; Antisense; AATCCTATCGACTGGCTACTTCAAA
>probe:Drosophila_2:1627680_at:239:241; Interrogation_Position=3537; Antisense; AATAACTCTTACTCTGGGACACACT
>probe:Drosophila_2:1627680_at:122:373; Interrogation_Position=3589; Antisense; GAAGAGGCACTGACCACTATATATG
>probe:Drosophila_2:1627680_at:234:55; Interrogation_Position=3652; Antisense; ATGAAGTTGTTGCAGCGCGCCATAC
>probe:Drosophila_2:1627680_at:254:313; Interrogation_Position=3700; Antisense; GCCAGACAATTACTTTCCGCTATTA

Paste this into a BLAST search page for me
AACCCTACTCTATCAGTGTGTCTTGGTGTCTTGTTGAAGGAGGTCCCCATATTCAGGCGTTGTTTTCAGCCCTTGGACGGAGCTGAATGCGTACGCCTTTGAGTATTGTGCCGACATATCCTATTTTAACGGCTCACTACATCCTGATAAAGCGTTGTGCTATCTACAGACTCGCGACTCGCATACGAATGTTTCCCAATATTCCCGAAGTCTGCGAAGTGTCGTAATCCTATCGACTGGCTACTTCAAAAATAACTCTTACTCTGGGACACACTGAAGAGGCACTGACCACTATATATGATGAAGTTGTTGCAGCGCGCCATACGCCAGACAATTACTTTCCGCTATTA

Full Affymetrix probeset data:

Annotations for 1627680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720