FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627681_at:

>probe:Drosophila_2:1627681_at:249:651; Interrogation_Position=156; Antisense; TCACGAGGAACATCACGGTCATCAT
>probe:Drosophila_2:1627681_at:612:347; Interrogation_Position=195; Antisense; GCATGATGATCACCATGACTCCCAT
>probe:Drosophila_2:1627681_at:106:431; Interrogation_Position=223; Antisense; GAGTATGACTTCCAGTACGGCGTCA
>probe:Drosophila_2:1627681_at:44:609; Interrogation_Position=282; Antisense; TGAGTCACGACATGGCCACACGGTT
>probe:Drosophila_2:1627681_at:200:155; Interrogation_Position=299; Antisense; ACACGGTTACCGGACACTATGAGTT
>probe:Drosophila_2:1627681_at:128:429; Interrogation_Position=319; Antisense; GAGTTGATCGATGCCGATGGCCACA
>probe:Drosophila_2:1627681_at:46:69; Interrogation_Position=335; Antisense; ATGGCCACAAGCGAACTGTCCACTA
>probe:Drosophila_2:1627681_at:273:439; Interrogation_Position=385; Antisense; GAGGCTCATGTCCATCGCGAGAAGC
>probe:Drosophila_2:1627681_at:302:69; Interrogation_Position=437; Antisense; ATGGCCATGGACACAGCGGCTACGA
>probe:Drosophila_2:1627681_at:328:559; Interrogation_Position=466; Antisense; GGACACGTTGAGTTCGAGGAGCACT
>probe:Drosophila_2:1627681_at:505:135; Interrogation_Position=506; Antisense; ACGACTATGGCCACGGACACGAGGA
>probe:Drosophila_2:1627681_at:269:67; Interrogation_Position=551; Antisense; ATGGACATGGTCACGGAAGCAGCTC
>probe:Drosophila_2:1627681_at:206:141; Interrogation_Position=626; Antisense; ACGGTCAGGATCATGGTTTCGAGCA
>probe:Drosophila_2:1627681_at:357:693; Interrogation_Position=642; Antisense; TTTCGAGCACGGACACGGTTACCAT

Paste this into a BLAST search page for me
TCACGAGGAACATCACGGTCATCATGCATGATGATCACCATGACTCCCATGAGTATGACTTCCAGTACGGCGTCATGAGTCACGACATGGCCACACGGTTACACGGTTACCGGACACTATGAGTTGAGTTGATCGATGCCGATGGCCACAATGGCCACAAGCGAACTGTCCACTAGAGGCTCATGTCCATCGCGAGAAGCATGGCCATGGACACAGCGGCTACGAGGACACGTTGAGTTCGAGGAGCACTACGACTATGGCCACGGACACGAGGAATGGACATGGTCACGGAAGCAGCTCACGGTCAGGATCATGGTTTCGAGCATTTCGAGCACGGACACGGTTACCAT

Full Affymetrix probeset data:

Annotations for 1627681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720