FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627682_at:

>probe:Drosophila_2:1627682_at:298:367; Interrogation_Position=159; Antisense; GAATCTCTATGTGGTCAAGGCGGTG
>probe:Drosophila_2:1627682_at:322:519; Interrogation_Position=181; Antisense; GTGGTCTATGAGATCGGCATCCTGA
>probe:Drosophila_2:1627682_at:698:367; Interrogation_Position=219; Antisense; GAATGACACCAGTTTTGAGAGCCAG
>probe:Drosophila_2:1627682_at:697:71; Interrogation_Position=242; Antisense; AGGAACGCGTGGATCTGACCTTCTA
>probe:Drosophila_2:1627682_at:242:89; Interrogation_Position=286; Antisense; AGTCACATTGACCTGGGCAACATCC
>probe:Drosophila_2:1627682_at:45:511; Interrogation_Position=364; Antisense; GTGAATCTGGGAGCCTTCAGCAGCC
>probe:Drosophila_2:1627682_at:722:297; Interrogation_Position=413; Antisense; CCCTGACCGGAAGCATTGTGAACAT
>probe:Drosophila_2:1627682_at:357:131; Interrogation_Position=451; Antisense; ACCGCCTTCTATCAACTGAGCAGAT
>probe:Drosophila_2:1627682_at:452:349; Interrogation_Position=470; Antisense; GCAGATCGAACACCAGTGCCGCGGA
>probe:Drosophila_2:1627682_at:680:625; Interrogation_Position=486; Antisense; TGCCGCGGACAAGCCACAGATTCTG
>probe:Drosophila_2:1627682_at:515:463; Interrogation_Position=504; Antisense; GATTCTGGATCAGGATGCGCTGGCC
>probe:Drosophila_2:1627682_at:289:43; Interrogation_Position=561; Antisense; ATCGTCGCAAATTGGCCAGTCGGTG
>probe:Drosophila_2:1627682_at:270:83; Interrogation_Position=588; Antisense; AGTGAACCCAGCTGCCGATAACGAG
>probe:Drosophila_2:1627682_at:503:625; Interrogation_Position=80; Antisense; TGCCCGTTTTGGATGCCAGTTCAGG

Paste this into a BLAST search page for me
GAATCTCTATGTGGTCAAGGCGGTGGTGGTCTATGAGATCGGCATCCTGAGAATGACACCAGTTTTGAGAGCCAGAGGAACGCGTGGATCTGACCTTCTAAGTCACATTGACCTGGGCAACATCCGTGAATCTGGGAGCCTTCAGCAGCCCCCTGACCGGAAGCATTGTGAACATACCGCCTTCTATCAACTGAGCAGATGCAGATCGAACACCAGTGCCGCGGATGCCGCGGACAAGCCACAGATTCTGGATTCTGGATCAGGATGCGCTGGCCATCGTCGCAAATTGGCCAGTCGGTGAGTGAACCCAGCTGCCGATAACGAGTGCCCGTTTTGGATGCCAGTTCAGG

Full Affymetrix probeset data:

Annotations for 1627682_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720