Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627684_at:

>probe:Drosophila_2:1627684_at:208:587; Interrogation_Position=6477; Antisense; TGGAGTTTCCGGACATCAGGCTTTA
>probe:Drosophila_2:1627684_at:647:35; Interrogation_Position=6491; Antisense; ATCAGGCTTTATGCCACAGCGAGGA
>probe:Drosophila_2:1627684_at:140:437; Interrogation_Position=6511; Antisense; GAGGAACCCAATCTCATCGAGGACG
>probe:Drosophila_2:1627684_at:433:595; Interrogation_Position=6570; Antisense; TGTGTTCAGTTGTCTATATCCCGGT
>probe:Drosophila_2:1627684_at:214:21; Interrogation_Position=6585; Antisense; ATATCCCGGTTGTATGGTGTACCAG
>probe:Drosophila_2:1627684_at:610:517; Interrogation_Position=6609; Antisense; GTGGGATGTTATCTCCAAGCGGATA
>probe:Drosophila_2:1627684_at:353:207; Interrogation_Position=6640; Antisense; AAGCTGGACTGCTCAAAGCTGCTGC
>probe:Drosophila_2:1627684_at:563:333; Interrogation_Position=6668; Antisense; GCTCCGAGTCTCTGCAAAGTATTGC
>probe:Drosophila_2:1627684_at:216:583; Interrogation_Position=6737; Antisense; TGGCGGCTCACAATTCAGAACTGTA
>probe:Drosophila_2:1627684_at:470:273; Interrogation_Position=6816; Antisense; CATTAGTGTTTTCCGACCCTATGAA
>probe:Drosophila_2:1627684_at:730:171; Interrogation_Position=6871; Antisense; AAAGACAATGTTCCGCTGATCGCCA
>probe:Drosophila_2:1627684_at:511:211; Interrogation_Position=6903; Antisense; AAGACGATATCGCTCTCTGATCTCT
>probe:Drosophila_2:1627684_at:561:643; Interrogation_Position=6925; Antisense; TCTCGATATGTGGACTCCGCAGAGT
>probe:Drosophila_2:1627684_at:286:545; Interrogation_Position=7020; Antisense; GGATAATCACATTCATTGCCTGCTG

Paste this into a BLAST search page for me
TGGAGTTTCCGGACATCAGGCTTTAATCAGGCTTTATGCCACAGCGAGGAGAGGAACCCAATCTCATCGAGGACGTGTGTTCAGTTGTCTATATCCCGGTATATCCCGGTTGTATGGTGTACCAGGTGGGATGTTATCTCCAAGCGGATAAAGCTGGACTGCTCAAAGCTGCTGCGCTCCGAGTCTCTGCAAAGTATTGCTGGCGGCTCACAATTCAGAACTGTACATTAGTGTTTTCCGACCCTATGAAAAAGACAATGTTCCGCTGATCGCCAAAGACGATATCGCTCTCTGATCTCTTCTCGATATGTGGACTCCGCAGAGTGGATAATCACATTCATTGCCTGCTG

Full Affymetrix probeset data:

Annotations for 1627684_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime