Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627685_a_at:

>probe:Drosophila_2:1627685_a_at:341:291; Interrogation_Position=220; Antisense; CGTACCAAGCAAACAGCCCGTAAAT
>probe:Drosophila_2:1627685_a_at:365:663; Interrogation_Position=240; Antisense; TAAATCGACCGGAGGCAAGGCGCCC
>probe:Drosophila_2:1627685_a_at:650:85; Interrogation_Position=318; Antisense; AGTGAAGAAGCCACATCGCTACCGT
>probe:Drosophila_2:1627685_a_at:329:589; Interrogation_Position=363; Antisense; TGAGATTCGTCGCTACCAGAAGTCC
>probe:Drosophila_2:1627685_a_at:665:307; Interrogation_Position=417; Antisense; CCAGCGTCTGGTGCGCGAGATAGCC
>probe:Drosophila_2:1627685_a_at:249:457; Interrogation_Position=435; Antisense; GATAGCCCAGGACTTCAAGACCGAT
>probe:Drosophila_2:1627685_a_at:163:87; Interrogation_Position=470; Antisense; AGTCGGCGGCCATTGGAGCCCTACA
>probe:Drosophila_2:1627685_a_at:438:665; Interrogation_Position=491; Antisense; TACAGGAGGCCAGCGAGGCGTACCT
>probe:Drosophila_2:1627685_a_at:160:531; Interrogation_Position=516; Antisense; GGTCGGTCTGTTCGAGGACACCAAT
>probe:Drosophila_2:1627685_a_at:525:575; Interrogation_Position=561; Antisense; GGCGAGCGGGCCTAAATGCCCATGA
>probe:Drosophila_2:1627685_a_at:713:307; Interrogation_Position=580; Antisense; CCATGACCGCCATCTTGGATTGGAA
>probe:Drosophila_2:1627685_a_at:729:247; Interrogation_Position=626; Antisense; CAACCCACAGCTGTCGCTTGGAGGG
>probe:Drosophila_2:1627685_a_at:56:319; Interrogation_Position=711; Antisense; GCCGCCGCTTAGTACTTAGGTCTAT
>probe:Drosophila_2:1627685_a_at:390:657; Interrogation_Position=726; Antisense; TTAGGTCTATCTATACTTACCGATA

Paste this into a BLAST search page for me
CGTACCAAGCAAACAGCCCGTAAATTAAATCGACCGGAGGCAAGGCGCCCAGTGAAGAAGCCACATCGCTACCGTTGAGATTCGTCGCTACCAGAAGTCCCCAGCGTCTGGTGCGCGAGATAGCCGATAGCCCAGGACTTCAAGACCGATAGTCGGCGGCCATTGGAGCCCTACATACAGGAGGCCAGCGAGGCGTACCTGGTCGGTCTGTTCGAGGACACCAATGGCGAGCGGGCCTAAATGCCCATGACCATGACCGCCATCTTGGATTGGAACAACCCACAGCTGTCGCTTGGAGGGGCCGCCGCTTAGTACTTAGGTCTATTTAGGTCTATCTATACTTACCGATA

Full Affymetrix probeset data:

Annotations for 1627685_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime