FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627687_at:

>probe:Drosophila_2:1627687_at:320:441; Interrogation_Position=1023; Antisense; GATGGTAACCTTCGATTTCCGAGCC
>probe:Drosophila_2:1627687_at:98:637; Interrogation_Position=1118; Antisense; TCGAGAACATGGACGACCTGCTCTT
>probe:Drosophila_2:1627687_at:642:337; Interrogation_Position=1137; Antisense; GCTCTTCTGGTTCATCAGCATGTTA
>probe:Drosophila_2:1627687_at:632:59; Interrogation_Position=1156; Antisense; ATGTTACACAATGTCTACTCCAGCC
>probe:Drosophila_2:1627687_at:372:319; Interrogation_Position=1264; Antisense; GCCGCAGACCTGAAGAAGCCGTTTA
>probe:Drosophila_2:1627687_at:440:201; Interrogation_Position=781; Antisense; AACCTCAACATTCCGGATGCTATCG
>probe:Drosophila_2:1627687_at:259:315; Interrogation_Position=808; Antisense; GCCATTCGGTCGCAGCACAAGATGA
>probe:Drosophila_2:1627687_at:565:357; Interrogation_Position=822; Antisense; GCACAAGATGAACTTCCGGCTGGAG
>probe:Drosophila_2:1627687_at:548:477; Interrogation_Position=852; Antisense; GTTTTACACGCACATGGAGGCCGAT
>probe:Drosophila_2:1627687_at:187:357; Interrogation_Position=881; Antisense; GCAATCCCATGTACAACCGGAACGT
>probe:Drosophila_2:1627687_at:313:129; Interrogation_Position=896; Antisense; ACCGGAACGTTGCTGTGCAGTTGTC
>probe:Drosophila_2:1627687_at:31:267; Interrogation_Position=913; Antisense; CAGTTGTCGCGGGTTTTCCAGATAA
>probe:Drosophila_2:1627687_at:408:455; Interrogation_Position=933; Antisense; GATAACACTCCAGATGTTCCAGCAC
>probe:Drosophila_2:1627687_at:381:313; Interrogation_Position=958; Antisense; GCCAGCGTGCGAAACAATGTACCCA

Paste this into a BLAST search page for me
GATGGTAACCTTCGATTTCCGAGCCTCGAGAACATGGACGACCTGCTCTTGCTCTTCTGGTTCATCAGCATGTTAATGTTACACAATGTCTACTCCAGCCGCCGCAGACCTGAAGAAGCCGTTTAAACCTCAACATTCCGGATGCTATCGGCCATTCGGTCGCAGCACAAGATGAGCACAAGATGAACTTCCGGCTGGAGGTTTTACACGCACATGGAGGCCGATGCAATCCCATGTACAACCGGAACGTACCGGAACGTTGCTGTGCAGTTGTCCAGTTGTCGCGGGTTTTCCAGATAAGATAACACTCCAGATGTTCCAGCACGCCAGCGTGCGAAACAATGTACCCA

Full Affymetrix probeset data:

Annotations for 1627687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720