FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627688_at:

>probe:Drosophila_2:1627688_at:291:63; Interrogation_Position=1029; Antisense; ATGTGCCGCGCATTTTTCTGCAAGG
>probe:Drosophila_2:1627688_at:269:17; Interrogation_Position=591; Antisense; ATTTCTCACCGCGAGCAGTGGAATT
>probe:Drosophila_2:1627688_at:495:83; Interrogation_Position=607; Antisense; AGTGGAATTCGTGCGCTCCAATCCT
>probe:Drosophila_2:1627688_at:250:127; Interrogation_Position=644; Antisense; AGCCAGATATCTGCCTTTCAGTGTG
>probe:Drosophila_2:1627688_at:403:199; Interrogation_Position=676; Antisense; AACGCAACAGGTGCATGACCACATC
>probe:Drosophila_2:1627688_at:463:585; Interrogation_Position=714; Antisense; TGGACATTTGCACGCTGATCTTTGT
>probe:Drosophila_2:1627688_at:126:75; Interrogation_Position=808; Antisense; AGGACTGCTTCTGTTTAGGGATTAC
>probe:Drosophila_2:1627688_at:32:537; Interrogation_Position=833; Antisense; GGTCTCTACGACATGGCACAGTTGC
>probe:Drosophila_2:1627688_at:674:251; Interrogation_Position=849; Antisense; CACAGTTGCGCTTTAAGCCGGGCAA
>probe:Drosophila_2:1627688_at:684:491; Interrogation_Position=896; Antisense; GTAAGACAGGATGGCACCCGTAGCT
>probe:Drosophila_2:1627688_at:72:133; Interrogation_Position=911; Antisense; ACCCGTAGCTACTTCTTTTCAGAGG
>probe:Drosophila_2:1627688_at:9:107; Interrogation_Position=960; Antisense; AGAACGGCTTTGAGGTCATTACCAA
>probe:Drosophila_2:1627688_at:175:13; Interrogation_Position=977; Antisense; ATTACCAATGCCTATGTCCATCGTC
>probe:Drosophila_2:1627688_at:503:505; Interrogation_Position=992; Antisense; GTCCATCGTCGAACTCTAAATCTTA

Paste this into a BLAST search page for me
ATGTGCCGCGCATTTTTCTGCAAGGATTTCTCACCGCGAGCAGTGGAATTAGTGGAATTCGTGCGCTCCAATCCTAGCCAGATATCTGCCTTTCAGTGTGAACGCAACAGGTGCATGACCACATCTGGACATTTGCACGCTGATCTTTGTAGGACTGCTTCTGTTTAGGGATTACGGTCTCTACGACATGGCACAGTTGCCACAGTTGCGCTTTAAGCCGGGCAAGTAAGACAGGATGGCACCCGTAGCTACCCGTAGCTACTTCTTTTCAGAGGAGAACGGCTTTGAGGTCATTACCAAATTACCAATGCCTATGTCCATCGTCGTCCATCGTCGAACTCTAAATCTTA

Full Affymetrix probeset data:

Annotations for 1627688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720