FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627689_at:

>probe:Drosophila_2:1627689_at:665:717; Interrogation_Position=1007; Antisense; TTCCGGGCAAGGAAAGCGCCAAAAG
>probe:Drosophila_2:1627689_at:89:119; Interrogation_Position=912; Antisense; AGCTCGATTTCCCAAACTGTCCACA
>probe:Drosophila_2:1627689_at:311:637; Interrogation_Position=915; Antisense; TCGATTTCCCAAACTGTCCACAGAA
>probe:Drosophila_2:1627689_at:86:695; Interrogation_Position=919; Antisense; TTTCCCAAACTGTCCACAGAACATC
>probe:Drosophila_2:1627689_at:16:179; Interrogation_Position=925; Antisense; AAACTGTCCACAGAACATCATATCA
>probe:Drosophila_2:1627689_at:529:155; Interrogation_Position=934; Antisense; ACAGAACATCATATCAGTGCGGCAC
>probe:Drosophila_2:1627689_at:586:107; Interrogation_Position=936; Antisense; AGAACATCATATCAGTGCGGCACAC
>probe:Drosophila_2:1627689_at:479:385; Interrogation_Position=937; Antisense; GAACATCATATCAGTGCGGCACACT
>probe:Drosophila_2:1627689_at:409:151; Interrogation_Position=939; Antisense; ACATCATATCAGTGCGGCACACTCC
>probe:Drosophila_2:1627689_at:425:23; Interrogation_Position=944; Antisense; ATATCAGTGCGGCACACTCCTGCGC
>probe:Drosophila_2:1627689_at:239:331; Interrogation_Position=989; Antisense; GCGGCACTCAGCCAAGTTTTCCGGG
>probe:Drosophila_2:1627689_at:101:357; Interrogation_Position=992; Antisense; GCACTCAGCCAAGTTTTCCGGGCAA
>probe:Drosophila_2:1627689_at:507:133; Interrogation_Position=994; Antisense; ACTCAGCCAAGTTTTCCGGGCAAGG
>probe:Drosophila_2:1627689_at:127:635; Interrogation_Position=996; Antisense; TCAGCCAAGTTTTCCGGGCAAGGAA

Paste this into a BLAST search page for me
TTCCGGGCAAGGAAAGCGCCAAAAGAGCTCGATTTCCCAAACTGTCCACATCGATTTCCCAAACTGTCCACAGAATTTCCCAAACTGTCCACAGAACATCAAACTGTCCACAGAACATCATATCAACAGAACATCATATCAGTGCGGCACAGAACATCATATCAGTGCGGCACACGAACATCATATCAGTGCGGCACACTACATCATATCAGTGCGGCACACTCCATATCAGTGCGGCACACTCCTGCGCGCGGCACTCAGCCAAGTTTTCCGGGGCACTCAGCCAAGTTTTCCGGGCAAACTCAGCCAAGTTTTCCGGGCAAGGTCAGCCAAGTTTTCCGGGCAAGGAA

Full Affymetrix probeset data:

Annotations for 1627689_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720