FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627691_at:

>probe:Drosophila_2:1627691_at:77:391; Interrogation_Position=1030; Antisense; GAAACTTACACTTCGAGCCAATGAT
>probe:Drosophila_2:1627691_at:715:47; Interrogation_Position=1082; Antisense; ATCCACATTATATTCTCTTCACAGC
>probe:Drosophila_2:1627691_at:236:565; Interrogation_Position=1162; Antisense; GGCAAGGCACCTACTATTTTTGTGT
>probe:Drosophila_2:1627691_at:70:515; Interrogation_Position=1183; Antisense; GTGTTAGCATTTCAGTTCACTTGCA
>probe:Drosophila_2:1627691_at:68:643; Interrogation_Position=691; Antisense; TCTGAGGAGAGCTGCGTGCCGCTTA
>probe:Drosophila_2:1627691_at:385:505; Interrogation_Position=706; Antisense; GTGCCGCTTAAGTACCTTCAGGAGC
>probe:Drosophila_2:1627691_at:197:469; Interrogation_Position=738; Antisense; GTTGCACGAGGACTGGTTGATACAC
>probe:Drosophila_2:1627691_at:80:727; Interrogation_Position=754; Antisense; TTGATACACCAGAGACGACCGCAGT
>probe:Drosophila_2:1627691_at:708:87; Interrogation_Position=776; Antisense; AGTCGTGCAAGGTCCTAGTCCTCGA
>probe:Drosophila_2:1627691_at:60:283; Interrogation_Position=796; Antisense; CTCGATGCCGATCTGAACCTGGAAA
>probe:Drosophila_2:1627691_at:110:425; Interrogation_Position=847; Antisense; GAGAGCAGCATATTCGACGCCATCT
>probe:Drosophila_2:1627691_at:550:411; Interrogation_Position=862; Antisense; GACGCCATCTCAAGTAACCAACAGC
>probe:Drosophila_2:1627691_at:102:433; Interrogation_Position=921; Antisense; GAGGGTCGCCAGATAACCATTATCC
>probe:Drosophila_2:1627691_at:324:213; Interrogation_Position=993; Antisense; AAGAGGCCTAGACGAGCCGATTCGC

Paste this into a BLAST search page for me
GAAACTTACACTTCGAGCCAATGATATCCACATTATATTCTCTTCACAGCGGCAAGGCACCTACTATTTTTGTGTGTGTTAGCATTTCAGTTCACTTGCATCTGAGGAGAGCTGCGTGCCGCTTAGTGCCGCTTAAGTACCTTCAGGAGCGTTGCACGAGGACTGGTTGATACACTTGATACACCAGAGACGACCGCAGTAGTCGTGCAAGGTCCTAGTCCTCGACTCGATGCCGATCTGAACCTGGAAAGAGAGCAGCATATTCGACGCCATCTGACGCCATCTCAAGTAACCAACAGCGAGGGTCGCCAGATAACCATTATCCAAGAGGCCTAGACGAGCCGATTCGC

Full Affymetrix probeset data:

Annotations for 1627691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720