FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627693_at:

>probe:Drosophila_2:1627693_at:303:83; Interrogation_Position=2521; Antisense; AGGGCATCCTGGCTGATAAGCTACT
>probe:Drosophila_2:1627693_at:713:657; Interrogation_Position=2537; Antisense; TAAGCTACTGCGTGAGCTGGCGATT
>probe:Drosophila_2:1627693_at:590:3; Interrogation_Position=2559; Antisense; ATTGGAGCCCTTCTGAATCGTTACC
>probe:Drosophila_2:1627693_at:486:235; Interrogation_Position=2574; Antisense; AATCGTTACCTGTTATTAGCTATGC
>probe:Drosophila_2:1627693_at:12:677; Interrogation_Position=2590; Antisense; TAGCTATGCGAGTCTGCACGCCAAA
>probe:Drosophila_2:1627693_at:356:5; Interrogation_Position=2640; Antisense; ATTGTAAATACCCTGCCTACAGTCT
>probe:Drosophila_2:1627693_at:654:315; Interrogation_Position=2654; Antisense; GCCTACAGTCTGGTTGTTACCGAAC
>probe:Drosophila_2:1627693_at:93:603; Interrogation_Position=2668; Antisense; TGTTACCGAACAGCGAGACCCTCAA
>probe:Drosophila_2:1627693_at:625:233; Interrogation_Position=2751; Antisense; AATCCAATCTTTATGCAATCCAGCG
>probe:Drosophila_2:1627693_at:332:485; Interrogation_Position=2820; Antisense; GTAGGGACAAACATCGCTCACATCA
>probe:Drosophila_2:1627693_at:629:393; Interrogation_Position=2873; Antisense; GAAATGCACAACTTATATCGGTCTG
>probe:Drosophila_2:1627693_at:256:385; Interrogation_Position=2973; Antisense; GAACAGCCCTTCCAAACTAATCAAT
>probe:Drosophila_2:1627693_at:614:73; Interrogation_Position=3045; Antisense; AGGAACTCTGTTTAAGGCTCATCGT
>probe:Drosophila_2:1627693_at:215:573; Interrogation_Position=3060; Antisense; GGCTCATCGTTTTGTAACTTCATGC

Paste this into a BLAST search page for me
AGGGCATCCTGGCTGATAAGCTACTTAAGCTACTGCGTGAGCTGGCGATTATTGGAGCCCTTCTGAATCGTTACCAATCGTTACCTGTTATTAGCTATGCTAGCTATGCGAGTCTGCACGCCAAAATTGTAAATACCCTGCCTACAGTCTGCCTACAGTCTGGTTGTTACCGAACTGTTACCGAACAGCGAGACCCTCAAAATCCAATCTTTATGCAATCCAGCGGTAGGGACAAACATCGCTCACATCAGAAATGCACAACTTATATCGGTCTGGAACAGCCCTTCCAAACTAATCAATAGGAACTCTGTTTAAGGCTCATCGTGGCTCATCGTTTTGTAACTTCATGC

Full Affymetrix probeset data:

Annotations for 1627693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720