Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627694_at:

>probe:Drosophila_2:1627694_at:80:35; Interrogation_Position=4940; Antisense; ATCAGCAGAATCTACGACGTCCACA
>probe:Drosophila_2:1627694_at:385:451; Interrogation_Position=4965; Antisense; GATCGACCAGATGCCCTACAATAAT
>probe:Drosophila_2:1627694_at:124:199; Interrogation_Position=4997; Antisense; AACGATCACGATCCGATCTTCAGCT
>probe:Drosophila_2:1627694_at:151:235; Interrogation_Position=5035; Antisense; AATCCGGAGTGTGACCGTCTGTTGA
>probe:Drosophila_2:1627694_at:432:589; Interrogation_Position=5066; Antisense; TGGATCACAATCAACCTGGCAGCAT
>probe:Drosophila_2:1627694_at:689:251; Interrogation_Position=5103; Antisense; CAACAAACCGTCCATGTTCTGGTCA
>probe:Drosophila_2:1627694_at:15:61; Interrogation_Position=5116; Antisense; ATGTTCTGGTCACGCGAATCGCTAA
>probe:Drosophila_2:1627694_at:723:217; Interrogation_Position=5140; Antisense; AAGTACCTCGATGATCTTTTCAAGA
>probe:Drosophila_2:1627694_at:460:199; Interrogation_Position=5198; Antisense; AACGAGTGCTACAGCGATCGCAGCG
>probe:Drosophila_2:1627694_at:420:519; Interrogation_Position=5222; Antisense; GTGGTCTGCTGTCGCACAACGATTA
>probe:Drosophila_2:1627694_at:115:15; Interrogation_Position=5243; Antisense; ATTACCGAGCGGTCATTCGACTGCA
>probe:Drosophila_2:1627694_at:202:405; Interrogation_Position=5261; Antisense; GACTGCATTCCCTGATGTGCAACTG
>probe:Drosophila_2:1627694_at:641:359; Interrogation_Position=5279; Antisense; GCAACTGAGGATTAGCCAGGGTCAT
>probe:Drosophila_2:1627694_at:543:591; Interrogation_Position=5320; Antisense; TGGGTCACCTTCATTTTGTTTAACA

Paste this into a BLAST search page for me
ATCAGCAGAATCTACGACGTCCACAGATCGACCAGATGCCCTACAATAATAACGATCACGATCCGATCTTCAGCTAATCCGGAGTGTGACCGTCTGTTGATGGATCACAATCAACCTGGCAGCATCAACAAACCGTCCATGTTCTGGTCAATGTTCTGGTCACGCGAATCGCTAAAAGTACCTCGATGATCTTTTCAAGAAACGAGTGCTACAGCGATCGCAGCGGTGGTCTGCTGTCGCACAACGATTAATTACCGAGCGGTCATTCGACTGCAGACTGCATTCCCTGATGTGCAACTGGCAACTGAGGATTAGCCAGGGTCATTGGGTCACCTTCATTTTGTTTAACA

Full Affymetrix probeset data:

Annotations for 1627694_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime