FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627697_at:

>probe:Drosophila_2:1627697_at:473:585; Interrogation_Position=1015; Antisense; TGGAAGTTCTTCGATCACGCAGCGC
>probe:Drosophila_2:1627697_at:645:173; Interrogation_Position=1098; Antisense; AAAGCGCATTGGTCTACTGAATTAC
>probe:Drosophila_2:1627697_at:376:143; Interrogation_Position=1113; Antisense; ACTGAATTACTACCATGACCTGCGC
>probe:Drosophila_2:1627697_at:113:327; Interrogation_Position=1216; Antisense; GCGAGTAGCACTACGCTGTGTCAAT
>probe:Drosophila_2:1627697_at:598:213; Interrogation_Position=1241; Antisense; AAGAGTGACATCGTTCTGCCTTAGA
>probe:Drosophila_2:1627697_at:123:489; Interrogation_Position=714; Antisense; GTACGTGATGCACAGCTTTGCCAAC
>probe:Drosophila_2:1627697_at:291:297; Interrogation_Position=738; Antisense; CGCTGCGGCTGTATCGTTGGGTAAA
>probe:Drosophila_2:1627697_at:391:421; Interrogation_Position=763; Antisense; GAGCAATTCTTAGCGGTCTACCTCA
>probe:Drosophila_2:1627697_at:654:497; Interrogation_Position=796; Antisense; GTCTTCTCCAGTCTGATGAGCGTGC
>probe:Drosophila_2:1627697_at:309:57; Interrogation_Position=811; Antisense; ATGAGCGTGCTCTACAAGGCGGCCA
>probe:Drosophila_2:1627697_at:608:301; Interrogation_Position=854; Antisense; CCCTGGGTGCGTCTGGAGCTATAAT
>probe:Drosophila_2:1627697_at:29:339; Interrogation_Position=871; Antisense; GCTATAATGACACTGCTGGCCTATG
>probe:Drosophila_2:1627697_at:46:483; Interrogation_Position=906; Antisense; GTATCCGGACACACAACTTAGCATT
>probe:Drosophila_2:1627697_at:99:657; Interrogation_Position=980; Antisense; TAATGGGCATCGACTTTGCTGGCGT

Paste this into a BLAST search page for me
TGGAAGTTCTTCGATCACGCAGCGCAAAGCGCATTGGTCTACTGAATTACACTGAATTACTACCATGACCTGCGCGCGAGTAGCACTACGCTGTGTCAATAAGAGTGACATCGTTCTGCCTTAGAGTACGTGATGCACAGCTTTGCCAACCGCTGCGGCTGTATCGTTGGGTAAAGAGCAATTCTTAGCGGTCTACCTCAGTCTTCTCCAGTCTGATGAGCGTGCATGAGCGTGCTCTACAAGGCGGCCACCCTGGGTGCGTCTGGAGCTATAATGCTATAATGACACTGCTGGCCTATGGTATCCGGACACACAACTTAGCATTTAATGGGCATCGACTTTGCTGGCGT

Full Affymetrix probeset data:

Annotations for 1627697_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720