FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627698_at:

>probe:Drosophila_2:1627698_at:272:715; Interrogation_Position=1040; Antisense; TTCTTTGCTGTTTTTCTTTTTGTAT
>probe:Drosophila_2:1627698_at:461:689; Interrogation_Position=1095; Antisense; TATTATTATCTGTTTTGCTCTGCCA
>probe:Drosophila_2:1627698_at:186:695; Interrogation_Position=1108; Antisense; TTTGCTCTGCCAATGACTGCCGGAT
>probe:Drosophila_2:1627698_at:357:145; Interrogation_Position=1123; Antisense; ACTGCCGGATTCGTGTGATGTTCGT
>probe:Drosophila_2:1627698_at:30:655; Interrogation_Position=1293; Antisense; TAATTTGATTCCTCCGTTAACACTA
>probe:Drosophila_2:1627698_at:594:613; Interrogation_Position=1360; Antisense; TGAACGACGGCATGCACGCTTTATA
>probe:Drosophila_2:1627698_at:293:219; Interrogation_Position=1411; Antisense; AAGTGTATATGCGTAGGTCCTAATG
>probe:Drosophila_2:1627698_at:117:537; Interrogation_Position=1426; Antisense; GGTCCTAATGCTTATTTACTGCGTT
>probe:Drosophila_2:1627698_at:479:701; Interrogation_Position=1437; Antisense; TTATTTACTGCGTTTGCCGGGCGTA
>probe:Drosophila_2:1627698_at:183:627; Interrogation_Position=1451; Antisense; TGCCGGGCGTATTTACATATCTGTT
>probe:Drosophila_2:1627698_at:551:23; Interrogation_Position=1467; Antisense; ATATCTGTTGGCCTTTTGTACTCTA
>probe:Drosophila_2:1627698_at:684:721; Interrogation_Position=1482; Antisense; TTGTACTCTACGTGCTTTTTTCGCC
>probe:Drosophila_2:1627698_at:10:151; Interrogation_Position=947; Antisense; ACATCAATTCTCGTTCCGCAATTAA
>probe:Drosophila_2:1627698_at:71:129; Interrogation_Position=988; Antisense; ACCACATTCGTAGCAGTTGATTTTA

Paste this into a BLAST search page for me
TTCTTTGCTGTTTTTCTTTTTGTATTATTATTATCTGTTTTGCTCTGCCATTTGCTCTGCCAATGACTGCCGGATACTGCCGGATTCGTGTGATGTTCGTTAATTTGATTCCTCCGTTAACACTATGAACGACGGCATGCACGCTTTATAAAGTGTATATGCGTAGGTCCTAATGGGTCCTAATGCTTATTTACTGCGTTTTATTTACTGCGTTTGCCGGGCGTATGCCGGGCGTATTTACATATCTGTTATATCTGTTGGCCTTTTGTACTCTATTGTACTCTACGTGCTTTTTTCGCCACATCAATTCTCGTTCCGCAATTAAACCACATTCGTAGCAGTTGATTTTA

Full Affymetrix probeset data:

Annotations for 1627698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720